Transcript: Mouse NM_001302094.1

Mus musculus glial cell line derived neurotrophic factor family receptor alpha 2 (Gfra2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gfra2 (14586)
Length:
3172
CDS:
749..1828

Additional Resources:

NCBI RefSeq record:
NM_001302094.1
NBCI Gene record:
Gfra2 (14586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079140 TGGGTTTGATATGACACCGAA pLKO.1 1336 CDS 100% 2.640 3.696 N Gfra2 n/a
2 TRCN0000348667 TTGATATGACACCGAACTATG pLKO_005 1341 CDS 100% 10.800 8.640 N Gfra2 n/a
3 TRCN0000362617 TTGGAACCCAGCACGAAAGTT pLKO_005 1833 3UTR 100% 5.625 4.500 N Gfra2 n/a
4 TRCN0000362557 TTCACAGAGCTCACGACAAAT pLKO_005 1697 CDS 100% 13.200 9.240 N Gfra2 n/a
5 TRCN0000079141 CTGGCATGATTGGGTTTGATA pLKO.1 1326 CDS 100% 5.625 3.938 N Gfra2 n/a
6 TRCN0000079139 CCTGAACGACAACTGCAAGAA pLKO.1 940 CDS 100% 4.950 3.465 N Gfra2 n/a
7 TRCN0000335772 CCTGAACGACAACTGCAAGAA pLKO_005 940 CDS 100% 4.950 3.465 N Gfra2 n/a
8 TRCN0000079138 CGGAATGCCATTCAAGCCTTT pLKO.1 1478 CDS 100% 4.050 2.835 N Gfra2 n/a
9 TRCN0000060708 GCCAACAACTCCAAAGAGTTA pLKO.1 1667 CDS 100% 0.495 0.347 N GFRA2 n/a
10 TRCN0000362618 GAACCTTTCTCCTCCCAAATT pLKO_005 2080 3UTR 100% 13.200 7.920 N Gfra2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1902 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 1934 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00631 pDONR223 100% 69.3% 71.3% None (many diffs) n/a
2 ccsbBroad304_00631 pLX_304 0% 69.3% 71.3% V5 (many diffs) n/a
3 TRCN0000465990 CTTATAGGCCCCCTTGACCGTATG pLX_317 25.5% 69.3% 71.3% V5 (many diffs) n/a
Download CSV