Transcript: Mouse NM_001302122.1

Mus musculus ubiquitin specific peptidase 3 (Usp3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Usp3 (235441)
Length:
5388
CDS:
783..1598

Additional Resources:

NCBI RefSeq record:
NM_001302122.1
NBCI Gene record:
Usp3 (235441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030785 GTGTCTTTAGTAGAAGAGTTT pLKO.1 681 5UTR 100% 4.950 6.930 N Usp3 n/a
2 TRCN0000030786 CAGAGTTGTATATGTGCCATA pLKO.1 1174 CDS 100% 4.050 5.670 N Usp3 n/a
3 TRCN0000312963 TGCCACAGGCCTTCGAAATTT pLKO_005 519 5UTR 100% 15.000 12.000 N Usp3 n/a
4 TRCN0000312964 GTTTCACTGGACAGCATATTT pLKO_005 1274 CDS 100% 15.000 10.500 N Usp3 n/a
5 TRCN0000313032 AGTCGATACATACGTTCAATT pLKO_005 1304 CDS 100% 13.200 9.240 N Usp3 n/a
6 TRCN0000349845 CAACTACACCGGACAACATTT pLKO_005 1620 3UTR 100% 13.200 9.240 N Usp3 n/a
7 TRCN0000030784 GCAAGTAACAAATGCTGCATA pLKO.1 924 CDS 100% 4.950 3.465 N Usp3 n/a
8 TRCN0000030787 CTGGACATGAAGTGCTACCTA pLKO.1 1338 CDS 100% 3.000 2.100 N Usp3 n/a
9 TRCN0000311936 CTGGACATGAAGTGCTACCTA pLKO_005 1338 CDS 100% 3.000 2.100 N Usp3 n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 4304 3UTR 100% 4.950 2.475 Y Gad2 n/a
11 TRCN0000007605 GCCTCATATGTGGGACAGAAT pLKO.1 1006 CDS 100% 0.000 0.000 N USP3 n/a
12 TRCN0000320688 GCCTCATATGTGGGACAGAAT pLKO_005 1006 CDS 100% 0.000 0.000 N USP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02275 pDONR223 100% 46% 50.1% None (many diffs) n/a
2 ccsbBroad304_02275 pLX_304 0% 46% 50.1% V5 (many diffs) n/a
3 TRCN0000469117 AATTGGACTGAGCGCTCAGCCACA pLX_317 23.7% 46% 50.1% V5 (many diffs) n/a
Download CSV