Construct: ORF TRCN0000469117
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002583.1_s317c1
- Derived from:
- ccsbBroadEn_02275
- DNA Barcode:
- AATTGGACTGAGCGCTCAGCCACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP3 (9960)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469117
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | NM_006537.4 | 100% | 100% | |
| 2 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | XM_017022763.1 | 95.5% | 94.6% | (many diffs) |
| 3 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | XM_017022764.1 | 95.5% | 94.6% | (many diffs) |
| 4 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | XM_017022765.1 | 95.5% | 94.6% | (many diffs) |
| 5 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | NM_001256702.1 | 91.5% | 91.3% | 151_152ins132 |
| 6 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | XM_017022766.1 | 83.6% | 83.6% | 0_1ins255 |
| 7 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | XM_017022767.1 | 83.6% | 83.6% | 0_1ins255 |
| 8 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | XM_017022768.1 | 67.5% | 67.5% | 0_1ins507 |
| 9 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | NR_046342.2 | 27.6% | 1_147del;298_413del;1824_5633del | |
| 10 | human | 9960 | USP3 | ubiquitin specific peptidase 3 | NR_046341.2 | 27.5% | 1_147del;238_390del;1861_5670del | |
| 11 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | NM_144937.4 | 90.7% | 96.5% | (many diffs) |
| 12 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | NM_001302116.1 | 83.7% | 89.2% | (many diffs) |
| 13 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | XM_006511110.3 | 75.9% | 78.9% | (many diffs) |
| 14 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | XM_017313339.1 | 75.5% | 81.1% | (many diffs) |
| 15 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | XM_017313340.1 | 75.5% | 81.1% | (many diffs) |
| 16 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | XM_017313341.1 | 75.5% | 81.1% | (many diffs) |
| 17 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | XM_011242729.2 | 60.6% | 65.3% | (many diffs) |
| 18 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | XM_006511114.3 | 53.5% | 56% | (many diffs) |
| 19 | mouse | 235441 | Usp3 | ubiquitin specific peptidase 3 | NM_001302122.1 | 46% | 50.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1629
- ORF length:
- 1560
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagtgtcca cacctgagct ccagcgtctg cattgctccg gactcagcca 121 agttccccaa cggctccccg tcgtcctggt gctgcagcgt gtgccggtcc aacaaaagcc 181 cttgggtctg tttgacttgt tcaagtgtcc actgtggaag gtatgtgaat ggccatgcaa 241 aaaaacatta tgaagatgca caagtacctt taaccaacca taagaaatca gaaaagcaag 301 ataaagttca gcacacagta tgtatggatt gcagtagcta cagtacatac tgttatcgct 361 gtgatgattt tgtggttaat gacaccaagc tgggactggt acagaaagtc agagaacact 421 tacagaactt ggaaaactca gctttcacag ctgacaggca taagaaaaga aaacttttgg 481 aaaactcaac actaaacagc aagttattaa aagtaaatgg aagcaccact gccatttgtg 541 ccacaggcct tcggaatttg gggaacacat gtttcatgaa tgccatcctt cagtcactca 601 gtaacattga gcagttttgc tgttatttca aagaactgcc cgccgtggag ttaaggaatg 661 ggaaaacagc aggaaggcgg acataccaca ccaggagcca aggggataac aatgtgtctt 721 tggtagaaga gtttagaaag acactctgtg ctttatggca aggcagccag actgcattta 781 gcccagagtc cttattttat gttgtttgga agattatgcc aaactttagg ggctatcaac 841 agcaggacgc ccatgaattc atgcgctacc ttttggacca cctacacttg gaacttcagg 901 gcggtttcaa cggtgtttcc cgctcagcaa ttctgcagga gaattctact ctgtctgcaa 961 gtaacaagtg ttgcataaat ggagcatcta ctgttgtcac ggctatattc ggaggcattc 1021 tccaaaatga ggttaactgc ctcatatgtg ggacagaatc tagaaagttt gatccattcc 1081 tagacctttc attagatatt ccaagtcagt tcagaagtaa gcgctctaag aatcaagaaa 1141 atggaccagt ttgttcgtta cgagattgtc ttcgcagttt taccgactta gaagaacttg 1201 atgagacaga gttatatatg tgccataaat gcaaaaagaa acaaaagtcc acaaaaaagt 1261 tttGGATTCA AAAACTACCC AAGGTGCTAT GCTTACATTT GAAAAGATTT CATTGGACAG 1321 CATATTTAAG AAATAAAGTT GATACATACG TAGAATTTCC ACTGAGAGGC CTAGACATGA 1381 AATGCTACTT ACTAGAGCCT GAGAACAGTG GCCCGGAGAG CTGCCTGTAT GACCTCGCCG 1441 CTGTGGTGGT GCACCATGGT TCCGGGGTTG GTTCTGGACA TTACACAGCA TACGCAACTC 1501 ACGAAGGCCG CTGGTTCCAC TTCAATGACA GTACTGTAAC ACTGACTGAC GAGGAGACTG 1561 TGGTGAAGGC GAAGGCCTAC ATCCTTTTCT ACGTGGAACA CCAGGCCAAA GCTGGATCGG 1621 ATAAACTTTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1681 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1741 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAATTGG ACTGAGCGCT CAGCCACAAC 1801 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt