Transcript: Mouse NM_001302389.1

Mus musculus phospholipid phosphatase 2 (Plpp2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Plpp2 (50784)
Length:
1610
CDS:
240..902

Additional Resources:

NCBI RefSeq record:
NM_001302389.1
NBCI Gene record:
Plpp2 (50784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336159 GGTGTACACAGACCGTCTTTA pLKO_005 299 CDS 100% 13.200 18.480 N Plpp2 n/a
2 TRCN0000336158 CATGTTGTTCCTGGCGCTATA pLKO_005 593 CDS 100% 10.800 15.120 N Plpp2 n/a
3 TRCN0000081457 CTTTGGCATGTATTGCATGTT pLKO.1 578 CDS 100% 4.950 6.930 N Plpp2 n/a
4 TRCN0000081454 GCGATCCAACTTCAACAACTA pLKO.1 323 CDS 100% 4.950 3.960 N Plpp2 n/a
5 TRCN0000336161 ACCTGGCCAAGTACATGATTG pLKO_005 412 CDS 100% 10.800 7.560 N Plpp2 n/a
6 TRCN0000381061 ACCTGGCCAAGTACATGATTG pLKO_005 412 CDS 100% 10.800 7.560 N PLPP2 n/a
7 TRCN0000336099 AGGGCCCATCCTCTTCATTTC pLKO_005 1078 3UTR 100% 10.800 7.560 N Plpp2 n/a
8 TRCN0000336160 TGCAATCTATGTGGGCTATAC pLKO_005 686 CDS 100% 10.800 7.560 N Plpp2 n/a
9 TRCN0000081456 CCGTCTTTATTCGCGATCCAA pLKO.1 311 CDS 100% 3.000 2.100 N Plpp2 n/a
10 TRCN0000081455 CCTGGTGAATGCACCATATAA pLKO.1 149 5UTR 100% 1.500 1.050 N Plpp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01968 pDONR223 100% 64.5% 67.7% None (many diffs) n/a
2 ccsbBroad304_01968 pLX_304 0% 64.5% 67.7% V5 (many diffs) n/a
3 TRCN0000473645 TCGAACAACATATAAACTGATGAT pLX_317 6.5% 64.4% 70.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV