Construct: ORF TRCN0000473645
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009669.1_s317c1
- Derived from:
- ccsbBroadEn_01968
- DNA Barcode:
- TCGAACAACATATAAACTGATGAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PLPP2 (8612)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473645
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8612 | PLPP2 | phospholipid phosphatase 2 | NM_003712.4 | 99.8% | 95.4% | 824_825insG |
| 2 | human | 8612 | PLPP2 | phospholipid phosphatase 2 | XM_011528396.2 | 97.8% | 93.5% | 52_69del;842_843insG |
| 3 | human | 8612 | PLPP2 | phospholipid phosphatase 2 | NM_177543.3 | 90% | 82.3% | (many diffs) |
| 4 | human | 8612 | PLPP2 | phospholipid phosphatase 2 | NM_177526.3 | 80.4% | 76% | 0_1ins168;656_657insG |
| 5 | mouse | 50784 | Plpp2 | phospholipid phosphatase 2 | NM_015817.3 | 81% | 89.5% | (many diffs) |
| 6 | mouse | 50784 | Plpp2 | phospholipid phosphatase 2 | NM_001302389.1 | 64.4% | 70.3% | (many diffs) |
| 7 | mouse | 50784 | Plpp2 | phospholipid phosphatase 2 | NM_001302442.1 | 64.4% | 70.3% | (many diffs) |
| 8 | mouse | 50784 | Plpp2 | phospholipid phosphatase 2 | NM_001302390.1 | 45.9% | 49.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 894
- ORF length:
- 828
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gcggaggtgg gtcttcgtgc tgctcgacgt gctgtgctta ctggtcgcct 121 ccctgccctt cgctatcctg acgctggtga acgccccgta caagcgagga ttttactgcg 181 gggatgactc catccggtac ccctaccgtc cagataccat cacccacggg ctcatggctg 241 gggtcaccat cacggccacc gtcatccttg tctcggccgg ggaagcctac ctggtgtaca 301 cagaccggct ctattctcgc tcggacttca acaactacgt ggctgctgta tacaaggtgc 361 tggggacctt cctgtttggg gctgccgtga gccagtctct gacagacctg gccaagtaca 421 tgattgggcg tctgaggccc aacttcctag ccgtctgcga ccccgactgg agccgggtca 481 actgctcggt ctatgtgcag ctggagaagg tgtgcagggg aaaccctgct gatgtcaccg 541 aggccaggtt gtctttctac tcgggacact cttcctttgg gatgtactgc atggtgttct 601 tggcgctgta tgtgcaggca cgactctgtt ggaagtgggc acggctgctg cgacccacag 661 tccagttctt cctggtggcc tttgccctct acgtgggcta cacccgcgtg tctgattaca 721 aacaccactg gagcgatgtc cttgttggcc tcctgcaggg ggcactggtg gctgccctca 781 ctgtctgcta catctcagac ttcttcaaag cccgaccccc acagcactgt ctgaaggagg 841 aggagctgga acggaagccc agcctgtcac tgacgttgac cctGGGCGAG GGCTGACCAC 901 AACCACTATG GATACCCGCA CTCCTCCTCC TGCCCAACTT TCTTGTACAA AGTGGTTGAT 961 ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT 1021 CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATCGA 1081 ACAACATATA AACTGATGAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt 1141 gtgaaagatt