Transcript: Mouse NM_001302449.1

Mus musculus ring finger protein 10 (Rnf10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Mus musculus (mouse)
Gene:
Rnf10 (50849)
Length:
3120
CDS:
483..2894

Additional Resources:

NCBI RefSeq record:
NM_001302449.1
NBCI Gene record:
Rnf10 (50849)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041128 CCCTAAGAAGATCAACCTGAA pLKO.1 884 CDS 100% 4.050 3.240 N Rnf10 n/a
2 TRCN0000288381 CCCTAAGAAGATCAACCTGAA pLKO_005 884 CDS 100% 4.050 3.240 N Rnf10 n/a
3 TRCN0000295642 TCCATCGGGTTTCCTCTCTGT pLKO_005 2916 3UTR 100% 2.640 2.112 N Rnf10 n/a
4 TRCN0000295647 ATGCATCCTGCACTATCTTTC pLKO_005 1223 CDS 100% 10.800 7.560 N Rnf10 n/a
5 TRCN0000041129 CCCAAATCCAAGTGGGTGAAT pLKO.1 1404 CDS 100% 4.950 3.465 N Rnf10 n/a
6 TRCN0000041131 CGTCGCTCCAATTCACAGAAA pLKO.1 726 CDS 100% 4.950 3.465 N Rnf10 n/a
7 TRCN0000288307 CGTCGCTCCAATTCACAGAAA pLKO_005 726 CDS 100% 4.950 3.465 N Rnf10 n/a
8 TRCN0000041132 GTGGTAGAGATTGCTGGGTAT pLKO.1 2094 CDS 100% 4.050 2.835 N Rnf10 n/a
9 TRCN0000041130 CCTGTTTCATTGAGGCTGCTA pLKO.1 1576 CDS 100% 2.640 1.848 N Rnf10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07510 pDONR223 100% 90.5% 91.7% None (many diffs) n/a
2 ccsbBroad304_07510 pLX_304 0% 90.5% 91.7% V5 (many diffs) n/a
3 TRCN0000467243 AGGGGGGAGTATGCTCTATGCATA pLX_317 14.2% 90.5% 91.7% V5 (many diffs) n/a
Download CSV