Transcript: Human NM_001302504.1

Homo sapiens NLR family CARD domain containing 4 (NLRC4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
NLRC4 (58484)
Length:
1390
CDS:
276..1355

Additional Resources:

NCBI RefSeq record:
NM_001302504.1
NBCI Gene record:
NLRC4 (58484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163019 GCAGTTGAATTTGGCGGGAAA pLKO.1 1100 CDS 100% 4.050 5.670 N NLRC4 n/a
2 TRCN0000158998 GAACCTTACAAAGCTCATAAT pLKO.1 569 CDS 100% 13.200 10.560 N NLRC4 n/a
3 TRCN0000160665 CGCGAAGAAGTAAACATCATT pLKO.1 378 CDS 100% 5.625 3.938 N NLRC4 n/a
4 TRCN0000160604 CCCTTATTCAAAGAATGGGAA pLKO.1 304 CDS 100% 2.640 1.848 N NLRC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08776 pDONR223 100% 34.9% 34.9% None 22A>G;262_263ins1995;1074T>C n/a
2 ccsbBroad304_08776 pLX_304 0% 34.9% 34.9% V5 22A>G;262_263ins1995;1074T>C n/a
3 TRCN0000467727 CCCCTAATATCAATCCCCCCGCTC pLX_317 12.8% 34.9% 34.9% V5 22A>G;262_263ins1995;1074T>C n/a
Download CSV