Transcript: Mouse NM_001302798.1

Mus musculus RAB27B, member RAS oncogene family (Rab27b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rab27b (80718)
Length:
7383
CDS:
654..1310

Additional Resources:

NCBI RefSeq record:
NM_001302798.1
NBCI Gene record:
Rab27b (80718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100427 GCATACCATACTTCGAAACAA pLKO.1 1120 CDS 100% 5.625 7.875 N Rab27b n/a
2 TRCN0000324839 GCATACCATACTTCGAAACAA pLKO_005 1120 CDS 100% 5.625 7.875 N Rab27b n/a
3 TRCN0000380467 ACCCAGACATAGTATTAATTG pLKO_005 1027 CDS 100% 13.200 10.560 N Rab27b n/a
4 TRCN0000100429 CTCTATAGATACACAGACAAT pLKO.1 729 CDS 100% 4.950 3.960 N Rab27b n/a
5 TRCN0000381918 ATGAGTCAACTGCAGGCAAAT pLKO_005 993 CDS 100% 10.800 7.560 N Rab27b n/a
6 TRCN0000382353 GAGATGCCATGGGCTTCTTAC pLKO_005 922 CDS 100% 10.800 7.560 N Rab27b n/a
7 TRCN0000100426 CGGGAAGACAACATTTCTCTA pLKO.1 713 CDS 100% 4.950 3.465 N Rab27b n/a
8 TRCN0000324836 CGGGAAGACAACATTTCTCTA pLKO_005 713 CDS 100% 4.950 3.465 N Rab27b n/a
9 TRCN0000100428 GCTTCTGGACTTAATCATGAA pLKO.1 1181 CDS 100% 4.950 3.465 N Rab27b n/a
10 TRCN0000324837 GCTTCTGGACTTAATCATGAA pLKO_005 1181 CDS 100% 4.950 3.465 N Rab27b n/a
11 TRCN0000100425 CCTGAGACAATGTCAAACCAT pLKO.1 1356 3UTR 100% 3.000 2.100 N Rab27b n/a
12 TRCN0000324838 CCTGAGACAATGTCAAACCAT pLKO_005 1356 3UTR 100% 3.000 2.100 N Rab27b n/a
13 TRCN0000293978 CCAGTCAACAGAGCTTCTTAA pLKO_005 958 CDS 100% 13.200 9.240 N RAB27B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01362 pDONR223 100% 88.9% 94.4% None (many diffs) n/a
2 ccsbBroad304_01362 pLX_304 0% 88.9% 94.4% V5 (many diffs) n/a
3 TRCN0000470827 GAGCAAGATAAGCATAAGCAACTA pLX_317 59.4% 88.9% 94.4% V5 (many diffs) n/a
Download CSV