Transcript: Human NM_001302861.2

Homo sapiens epididymal peptidase inhibitor (EPPIN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
EPPIN (57119)
Length:
1975
CDS:
45..428

Additional Resources:

NCBI RefSeq record:
NM_001302861.2
NBCI Gene record:
EPPIN (57119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073592 ACCTGCAAGAATAAACGCTTT pLKO.1 431 3UTR 100% 4.050 3.240 N EPPIN n/a
2 TRCN0000373643 ATACCTGTGTCACTCTCAATT pLKO_005 710 3UTR 100% 13.200 9.240 N EPPIN n/a
3 TRCN0000373571 TTGCAGAGTAAGGGATCATTG pLKO_005 805 3UTR 100% 10.800 7.560 N EPPIN n/a
4 TRCN0000373644 CTGGTCTGACTGATTGGTTAT pLKO_005 109 CDS 100% 10.800 5.400 Y EPPIN n/a
5 TRCN0000073588 GCTGCACCTATCAACCCATTA pLKO.1 1281 3UTR 100% 10.800 5.400 Y EPPIN n/a
6 TRCN0000073590 TGGTGGTATGACAAGAAAGAT pLKO.1 332 CDS 100% 5.625 2.813 Y EPPIN n/a
7 TRCN0000073589 CCAGGGAAACAATAACAACTT pLKO.1 385 CDS 100% 4.950 2.475 Y EPPIN n/a
8 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 1241 3UTR 100% 4.950 2.475 Y OR11A1 n/a
9 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 1241 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302861.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03786 pDONR223 100% 90.2% 58.6% None 222_232del;381_382ins29 n/a
2 ccsbBroad304_03786 pLX_304 0% 90.2% 58.6% V5 222_232del;381_382ins29 n/a
3 TRCN0000481292 TATTGACGGGACACTCAACAGTAC pLX_317 100% 90.2% 58.6% V5 222_232del;381_382ins29 n/a
Download CSV