Transcript: Human NM_001303060.1

Homo sapiens transmembrane p24 trafficking protein 4 (TMED4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-01-26
Taxon:
Homo sapiens (human)
Gene:
TMED4 (222068)
Length:
2060
CDS:
490..873

Additional Resources:

NCBI RefSeq record:
NM_001303060.1
NBCI Gene record:
TMED4 (222068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072834 GCGCTGTTTCATCGAGGAAAT pLKO.1 206 5UTR 100% 10.800 15.120 N TMED4 n/a
2 TRCN0000072835 GCCAACAACTACCCTGAGATT pLKO.1 733 CDS 100% 4.950 3.465 N TMED4 n/a
3 TRCN0000072836 TGCCAACAACTACCCTGAGAT pLKO.1 732 CDS 100% 4.950 3.465 N TMED4 n/a
4 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 1124 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
5 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1697 3UTR 100% 1.080 0.540 Y GPR83 n/a
6 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1697 3UTR 100% 1.080 0.540 Y MYORG n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1232 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1232 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05268 pDONR223 100% 54.2% 53.3% None (many diffs) n/a
2 ccsbBroad304_05268 pLX_304 0% 54.2% 53.3% V5 (many diffs) n/a
3 TRCN0000491679 ACAGCACTAGCAGGAACCTGGACT pLX_317 46% 54.2% 53.3% V5 (many diffs) n/a
Download CSV