Transcript: Human NM_001303131.1

Homo sapiens growth arrest specific 2 like 3 (GAS2L3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-26
Taxon:
Homo sapiens (human)
Gene:
GAS2L3 (283431)
Length:
6131
CDS:
955..2727

Additional Resources:

NCBI RefSeq record:
NM_001303131.1
NBCI Gene record:
GAS2L3 (283431)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445300 ACGGACCAGGATTGGCTAATG pLKO_005 460 5UTR 100% 10.800 15.120 N GAS2L3 n/a
2 TRCN0000435403 ATATACCTGTAAGACCTAAAC pLKO_005 2159 CDS 100% 10.800 15.120 N GAS2L3 n/a
3 TRCN0000128567 GAAACTTAAATCGGCCTTGAA pLKO.1 2298 CDS 100% 4.950 6.930 N GAS2L3 n/a
4 TRCN0000117950 GCTCTATGTCAGTCCGTTCTA pLKO.1 1736 CDS 100% 4.950 6.930 N GAS2L3 n/a
5 TRCN0000130732 GCTCTATGTCAGTCCGTTCTA pLKO.1 1736 CDS 100% 4.950 6.930 N GAS2L3 n/a
6 TRCN0000128341 GTCAATCTGGTTATCTGGTTT pLKO.1 548 5UTR 100% 4.950 6.930 N GAS2L3 n/a
7 TRCN0000117951 AGTCCGTTCTAAATTGCCAAA pLKO.1 1746 CDS 100% 4.050 5.670 N GAS2L3 n/a
8 TRCN0000128473 GCTAATGTTTGTCAGTACGAT pLKO.1 474 5UTR 100% 3.000 4.200 N GAS2L3 n/a
9 TRCN0000128472 GCTTCATTAAATCCAGTAGGT pLKO.1 1861 CDS 100% 2.640 3.696 N GAS2L3 n/a
10 TRCN0000432001 TGTAGTTGTTCTCATCGATTT pLKO_005 1318 CDS 100% 10.800 8.640 N GAS2L3 n/a
11 TRCN0000117947 CGTGCCAGTTAGTATTCCAAA pLKO.1 1644 CDS 100% 4.950 3.960 N GAS2L3 n/a
12 TRCN0000435153 ACTTGATAATGGAGTACTATT pLKO_005 608 5UTR 100% 13.200 9.240 N GAS2L3 n/a
13 TRCN0000427425 CAATCTGGTTATCTGGTTTAT pLKO_005 550 5UTR 100% 13.200 9.240 N GAS2L3 n/a
14 TRCN0000412729 CACTTAGCTGCACATTCAAAT pLKO_005 2104 CDS 100% 13.200 9.240 N GAS2L3 n/a
15 TRCN0000130173 CCAAGCTGCCTAAAGCAAATA pLKO.1 2141 CDS 100% 13.200 9.240 N GAS2L3 n/a
16 TRCN0000413274 GAGCTACATGAAGCTGTTAAA pLKO_005 1276 CDS 100% 13.200 9.240 N GAS2L3 n/a
17 TRCN0000412351 TAATGAAAGTGTACCTGATTC pLKO_005 1542 CDS 100% 10.800 7.560 N GAS2L3 n/a
18 TRCN0000117948 GCGTGCCAGTTAGTATTCCAA pLKO.1 1643 CDS 100% 3.000 2.100 N GAS2L3 n/a
19 TRCN0000127750 GCTGGGATACTCTTCAAGGAT pLKO.1 1439 CDS 100% 3.000 2.100 N GAS2L3 n/a
20 TRCN0000129217 CCTGTAAGAAAGATGCTGCAT pLKO.1 968 CDS 100% 2.640 1.848 N GAS2L3 n/a
21 TRCN0000422919 GAATCCTTTGTCAGCAGTTAA pLKO_005 1593 CDS 100% 13.200 7.920 N GAS2L3 n/a
22 TRCN0000117949 CCTCTTTGAATCTGAAGGTTT pLKO.1 1065 CDS 100% 4.950 2.970 N GAS2L3 n/a
23 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4732 3UTR 100% 13.200 6.600 Y IQCC n/a
24 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 5326 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05356 pDONR223 100% 84.9% 85% None 0_1ins312;550T>C n/a
2 ccsbBroad304_05356 pLX_304 0% 84.9% 85% V5 0_1ins312;550T>C n/a
3 TRCN0000466768 GTGTGCCCTGCACCCCACTCTTGC pLX_317 18.6% 84.9% 85% V5 0_1ins312;550T>C n/a
Download CSV