Transcript: Human NM_001303247.2

Homo sapiens WD repeat domain 61 (WDR61), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
WDR61 (80349)
Length:
1308
CDS:
194..1111

Additional Resources:

NCBI RefSeq record:
NM_001303247.2
NBCI Gene record:
WDR61 (80349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330074 ATGTCGGGAAAGTGAACATTT pLKO_005 570 CDS 100% 13.200 9.240 N WDR61 n/a
2 TRCN0000179943 CATCAAAGTCTCCAGGCTTAT pLKO.1 1113 3UTR 100% 10.800 7.560 N WDR61 n/a
3 TRCN0000330145 CATCAAAGTCTCCAGGCTTAT pLKO_005 1113 3UTR 100% 10.800 7.560 N WDR61 n/a
4 TRCN0000183860 CTTACCTTCTTAGGCTTGTTT pLKO.1 1170 3UTR 100% 5.625 3.938 N WDR61 n/a
5 TRCN0000183149 GACCAGGAAATTCACATCTAT pLKO.1 1076 CDS 100% 5.625 3.938 N WDR61 n/a
6 TRCN0000147291 GATGGCTACATCAAGATCTAT pLKO.1 824 CDS 100% 5.625 3.938 N WDR61 n/a
7 TRCN0000149420 CCTTACCTTCTTAGGCTTGTT pLKO.1 1169 3UTR 100% 4.950 3.465 N WDR61 n/a
8 TRCN0000330146 CCTTACCTTCTTAGGCTTGTT pLKO_005 1169 3UTR 100% 4.950 3.465 N WDR61 n/a
9 TRCN0000149556 GACTTGTGTTCACACCTTCTT pLKO.1 985 CDS 100% 4.950 3.465 N WDR61 n/a
10 TRCN0000330144 GACTTGTGTTCACACCTTCTT pLKO_005 985 CDS 100% 4.950 3.465 N WDR61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09036 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_09036 pLX_304 0% 100% 100% V5 n/a
Download CSV