Transcript: Human NM_001303264.2

Homo sapiens TSC22 domain family member 2 (TSC22D2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
TSC22D2 (9819)
Length:
11110
CDS:
1054..3324

Additional Resources:

NCBI RefSeq record:
NM_001303264.2
NBCI Gene record:
TSC22D2 (9819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013519 CCGATGGACGTGTATGGAATA pLKO.1 1587 CDS 100% 10.800 15.120 N TSC22D2 n/a
2 TRCN0000369350 TCTTCCGAAGAGACGCTTAAC pLKO_005 1252 CDS 100% 10.800 15.120 N TSC22D2 n/a
3 TRCN0000364564 AGCAGGAGCAGCAGCATAATC pLKO_005 2695 CDS 100% 13.200 9.240 N TSC22D2 n/a
4 TRCN0000364639 CTGAGCCTTCCTATCACATTA pLKO_005 3658 3UTR 100% 13.200 9.240 N TSC22D2 n/a
5 TRCN0000369349 CTTTCTGATTCAGTAACATTT pLKO_005 3710 3UTR 100% 13.200 9.240 N TSC22D2 n/a
6 TRCN0000238118 TCTGTATTCAGCATAGCTATT pLKO_005 2968 CDS 100% 10.800 7.560 N Tsc22d2 n/a
7 TRCN0000369346 TCTGTATTCAGCATAGCTATT pLKO_005 2968 CDS 100% 10.800 7.560 N TSC22D2 n/a
8 TRCN0000013518 CCTGGCATATTTCTAACACTA pLKO.1 3916 3UTR 100% 4.950 3.465 N TSC22D2 n/a
9 TRCN0000013520 CCACTTTCTCTCATTGCTGAA pLKO.1 2866 CDS 100% 4.050 2.835 N TSC22D2 n/a
10 TRCN0000013521 CCACTTCTGTTACTATGCCAA pLKO.1 2621 CDS 100% 2.640 1.848 N TSC22D2 n/a
11 TRCN0000364638 CTTTCAAGCAATGATCAATTA pLKO_005 3187 CDS 100% 13.200 7.920 N TSC22D2 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 10896 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 7506 3UTR 100% 4.950 2.475 Y n/a
14 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 7581 3UTR 100% 1.080 0.540 Y GPR83 n/a
15 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 7581 3UTR 100% 1.080 0.540 Y MYORG n/a
16 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 10900 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303264.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.