Transcript: Mouse NM_001303273.1

Mus musculus TNF receptor-associated factor 6 (Traf6), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Traf6 (22034)
Length:
5985
CDS:
224..1816

Additional Resources:

NCBI RefSeq record:
NM_001303273.1
NBCI Gene record:
Traf6 (22034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001303273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321253 AGCGCTGTGCAAACTATATAT pLKO_005 1449 CDS 100% 15.000 21.000 N Traf6 n/a
2 TRCN0000350625 GACGGTAAAGTGCCCAAATAA pLKO_005 613 CDS 100% 15.000 21.000 N Traf6 n/a
3 TRCN0000321322 ATCAACTGTTTCCCGACAATT pLKO_005 567 CDS 100% 13.200 18.480 N Traf6 n/a
4 TRCN0000040737 GCCAGGTTAATACACACATTA pLKO.1 738 CDS 100% 13.200 10.560 N Traf6 n/a
5 TRCN0000321320 TTTAGGACACTGATTACTATA pLKO_005 2192 3UTR 100% 13.200 10.560 N Traf6 n/a
6 TRCN0000040735 CCCAGGCTGTTCATAATGTTA pLKO.1 1044 CDS 100% 5.625 4.500 N Traf6 n/a
7 TRCN0000321255 TCGTCCAGAGGACCCAAATTA pLKO_005 1111 CDS 100% 15.000 10.500 N Traf6 n/a
8 TRCN0000040734 CCCAAATTATGAGGAAACTAT pLKO.1 1123 CDS 100% 5.625 3.938 N Traf6 n/a
9 TRCN0000040736 GCCTGCATCATCAAATCCATA pLKO.1 497 CDS 100% 4.950 3.465 N Traf6 n/a
10 TRCN0000040733 CCTGTGAATTTCAGAGGCTTT pLKO.1 2295 3UTR 100% 4.050 2.835 N Traf6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303273.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10447 pDONR223 100% 86.1% 87.5% None (many diffs) n/a
2 ccsbBroad304_10447 pLX_304 0% 86.1% 87.5% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000468080 TCTTCATCCAGTACGCGATGTGTT pLX_317 23.7% 86.1% 87.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV