Transcript: Human NM_001303416.2

Homo sapiens ERCC excision repair 3, TFIIH core complex helicase subunit (ERCC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ERCC3 (2071)
Length:
2915
CDS:
453..2609

Additional Resources:

NCBI RefSeq record:
NM_001303416.2
NBCI Gene record:
ERCC3 (2071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359265 CGACTGAACAAACCCTATATC pLKO_005 1980 CDS 100% 13.200 18.480 N ERCC3 n/a
2 TRCN0000359267 GATCCGAGAATGCCGCTTAAG pLKO_005 839 CDS 100% 10.800 15.120 N ERCC3 n/a
3 TRCN0000359264 TCTTGGTAGATCAAGGTTATA pLKO_005 2296 CDS 100% 13.200 10.560 N ERCC3 n/a
4 TRCN0000359266 ACCCGCTCTTCAAGCGCTTTA pLKO_005 2581 CDS 100% 10.800 7.560 N ERCC3 n/a
5 TRCN0000022083 CGGGAATATGTGGCAATCAAA pLKO.1 1818 CDS 100% 5.625 3.938 N ERCC3 n/a
6 TRCN0000022080 CCGGAAGCAAATGTCCTCATT pLKO.1 2112 CDS 100% 4.950 3.465 N ERCC3 n/a
7 TRCN0000022079 GCCATTTCTAAGACTGCTGAA pLKO.1 915 CDS 100% 4.050 2.835 N ERCC3 n/a
8 TRCN0000022081 GCCCTAAAGGAATATGCCATT pLKO.1 1959 CDS 100% 4.050 2.835 N ERCC3 n/a
9 TRCN0000022082 CCAGTTTACAAATATGCCCAA pLKO.1 531 CDS 100% 2.160 1.512 N ERCC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00513 pDONR223 100% 91.8% 91.8% None 0_1ins192 n/a
2 ccsbBroad304_00513 pLX_304 0% 91.8% 91.8% V5 0_1ins192 n/a
Download CSV