Transcript: Human NM_001304.5

Homo sapiens carboxypeptidase D (CPD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CPD (1362)
Length:
9372
CDS:
55..4197

Additional Resources:

NCBI RefSeq record:
NM_001304.5
NBCI Gene record:
CPD (1362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415294 GAAGCTTTCCCGACCAGTTTA pLKO_005 707 CDS 100% 13.200 18.480 N CPD n/a
2 TRCN0000073875 GCACTGAATATCGTCACATTT pLKO.1 2939 CDS 100% 13.200 18.480 N CPD n/a
3 TRCN0000222511 CGCAGGAACAAGTTTGTGCTT pLKO.1 790 CDS 100% 2.640 2.112 N Cpd n/a
4 TRCN0000351895 CGCAGGAACAAGTTTGTGCTT pLKO_005 790 CDS 100% 2.640 2.112 N Cpd n/a
5 TRCN0000429091 AGCAGTCAGAATCGACATAAA pLKO_005 4595 3UTR 100% 13.200 9.240 N CPD n/a
6 TRCN0000073873 CCAGCATAAGTACCAAGCAAA pLKO.1 4219 3UTR 100% 4.950 3.465 N CPD n/a
7 TRCN0000073876 CGAGACTTTCAAAGATGGAAT pLKO.1 996 CDS 100% 4.950 3.465 N CPD n/a
8 TRCN0000073877 GCCAATCTCTAAAGCAGTCAT pLKO.1 3729 CDS 100% 4.950 3.465 N CPD n/a
9 TRCN0000073874 CCGGCTTTATTCCTTGGGAAA pLKO.1 1626 CDS 100% 4.050 2.835 N CPD n/a
10 TRCN0000434655 TTTGACCTGAACCGAAATTTC pLKO_005 1945 CDS 100% 13.200 7.920 N CPD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00356 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00356 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479351 GCCGCTCAATTCCAATCTCTAGTA pLX_317 12.9% 100% 100% V5 n/a
Download CSV