Transcript: Human NM_001304494.2

Homo sapiens zinc finger protein 23 (ZNF23), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
ZNF23 (7571)
Length:
2392
CDS:
139..1896

Additional Resources:

NCBI RefSeq record:
NM_001304494.2
NBCI Gene record:
ZNF23 (7571)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108130 GCCTTGTTGTTGGATAGGAAA pLKO.1 2260 3UTR 100% 4.950 6.930 N ZNF23 n/a
2 TRCN0000108134 CAGCTGTAGTTCTGCATATAT pLKO.1 831 CDS 100% 15.000 10.500 N ZNF23 n/a
3 TRCN0000434742 ACTTGGAAGAAACCCTATATG pLKO_005 1795 CDS 100% 13.200 9.240 N ZNF23 n/a
4 TRCN0000427114 GAAAGGCCTTCAGCGTTAATG pLKO_005 1325 CDS 100% 13.200 9.240 N ZNF23 n/a
5 TRCN0000108133 CCTTCCATGTTAATGCCCATT pLKO.1 1667 CDS 100% 4.050 2.835 N ZNF23 n/a
6 TRCN0000108132 GAAGAATTAGTAGAGCCCTTT pLKO.1 475 CDS 100% 4.050 2.835 N ZNF23 n/a
7 TRCN0000108131 GCCTTCAGTATCAATGCCAAA pLKO.1 1498 CDS 100% 4.050 2.835 N ZNF23 n/a
8 TRCN0000218191 GAGAAACCTTACGAGTGTAAT pLKO_005 877 CDS 100% 13.200 6.600 Y LOC676710 n/a
9 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 956 CDS 100% 5.625 2.813 Y ZNF345 n/a
10 TRCN0000149265 GAGTGTAATGAATGCGGGAAA pLKO.1 1225 CDS 100% 4.050 2.025 Y ZNF658B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01796 pDONR223 100% 90.9% 1% None 0_1ins174 n/a
2 ccsbBroad304_01796 pLX_304 0% 90.9% 1% V5 (not translated due to prior stop codon) 0_1ins174 n/a
3 TRCN0000467018 ACGCATAGGCGATTCACTTTACGA pLX_317 15.2% 90.9% 1% V5 (not translated due to prior stop codon) 0_1ins174 n/a
Download CSV