Transcript: Human NM_001304724.1

Homo sapiens pleckstrin homology domain containing O1 (PLEKHO1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PLEKHO1 (51177)
Length:
2010
CDS:
771..1451

Additional Resources:

NCBI RefSeq record:
NM_001304724.1
NBCI Gene record:
PLEKHO1 (51177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165365 GAGAGACCTGTACAGACAGAT pLKO.1 1358 CDS 100% 4.950 6.930 N PLEKHO1 n/a
2 TRCN0000165364 GAGAGGCATCATCGAATTGGA pLKO.1 1300 CDS 100% 3.000 4.200 N PLEKHO1 n/a
3 TRCN0000292422 GAGAGGCATCATCGAATTGGA pLKO_005 1300 CDS 100% 3.000 4.200 N PLEKHO1 n/a
4 TRCN0000202420 GAAATTCTGCGGGAAAGGGAT pLKO.1 410 5UTR 100% 2.640 3.696 N Plekho1 n/a
5 TRCN0000164405 CAAGAACCGTATCTTGGATGA pLKO.1 725 5UTR 100% 0.405 0.567 N PLEKHO1 n/a
6 TRCN0000165626 GCCAAGAACCGTATCTTGGAT pLKO.1 723 5UTR 100% 0.300 0.420 N PLEKHO1 n/a
7 TRCN0000292421 GCCAAGAACCGTATCTTGGAT pLKO_005 723 5UTR 100% 0.300 0.420 N PLEKHO1 n/a
8 TRCN0000165294 GCAAGTTTACTCTTGCCCACT pLKO.1 601 5UTR 100% 0.216 0.173 N PLEKHO1 n/a
9 TRCN0000339908 TCCGGAAATTCTGCGGGAAAG pLKO_005 406 5UTR 100% 6.000 4.200 N Plekho1 n/a
10 TRCN0000166349 CCAGCTCTACATCTCTGAGAA pLKO.1 476 5UTR 100% 4.950 3.465 N PLEKHO1 n/a
11 TRCN0000165452 GATGCTGACCTTGGACTTGAT pLKO.1 770 5UTR 100% 4.950 3.465 N PLEKHO1 n/a
12 TRCN0000161670 GTATTTGACCTGAGTGACTAT pLKO.1 528 5UTR 100% 4.950 3.465 N PLEKHO1 n/a
13 TRCN0000165913 GTGAGTCCAGAAGAGAAGGAA pLKO.1 666 5UTR 100% 3.000 2.100 N PLEKHO1 n/a
14 TRCN0000292497 GTGAGTCCAGAAGAGAAGGAA pLKO_005 666 5UTR 100% 3.000 2.100 N PLEKHO1 n/a
15 TRCN0000165209 GTTTACTCTTGCCCACTCCAA pLKO.1 605 5UTR 100% 2.640 1.848 N PLEKHO1 n/a
16 TRCN0000292498 GTTTACTCTTGCCCACTCCAA pLKO_005 605 5UTR 100% 2.640 1.848 N PLEKHO1 n/a
17 TRCN0000163147 GAGAAGGAATCGTGGATCAAT pLKO.1 678 5UTR 100% 5.625 3.375 N PLEKHO1 n/a
18 TRCN0000165914 GTCCAGAAGAGAAGGAATCGT pLKO.1 670 5UTR 100% 3.000 1.800 N PLEKHO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304724.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03238 pDONR223 100% 55.2% 55.2% None 0_1ins549 n/a
2 ccsbBroad304_03238 pLX_304 0% 55.2% 55.2% V5 0_1ins549 n/a
3 TRCN0000466090 CTCTGTACCGTATTTAGTGGACCC pLX_317 16.1% 55.2% 55.2% V5 0_1ins549 n/a
Download CSV