Transcript: Human NM_001304745.1

Homo sapiens nudix hydrolase 15 (NUDT15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
NUDT15 (55270)
Length:
934
CDS:
181..618

Additional Resources:

NCBI RefSeq record:
NM_001304745.1
NBCI Gene record:
NUDT15 (55270)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050310 GACTCATGATTCAGAACCAAA pLKO.1 489 CDS 100% 4.950 3.960 N NUDT15 n/a
2 TRCN0000289460 GACTCATGATTCAGAACCAAA pLKO_005 489 CDS 100% 4.950 3.960 N NUDT15 n/a
3 TRCN0000176847 GAGAAGGAGAATTACCATTAT pLKO.1 436 CDS 100% 13.200 9.240 N Nudt15 n/a
4 TRCN0000050308 CCTGGGAAGAATGTGCTCAAA pLKO.1 344 CDS 100% 4.950 2.970 N NUDT15 n/a
5 TRCN0000289395 CCTGGGAAGAATGTGCTCAAA pLKO_005 344 CDS 100% 4.950 2.970 N NUDT15 n/a
6 TRCN0000050311 GAAGCAGCTCTTCACCTGAAA pLKO.1 379 CDS 100% 4.950 2.970 N NUDT15 n/a
7 TRCN0000289457 GAAGCAGCTCTTCACCTGAAA pLKO_005 379 CDS 100% 4.950 2.970 N NUDT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08501 pDONR223 100% 79.9% 65.7% None (many diffs) n/a
2 ccsbBroad304_08501 pLX_304 0% 79.9% 65.7% V5 (many diffs) n/a
3 TRCN0000479998 ATACATACCTCCAAATAACTCGAT pLX_317 73.9% 79.9% 65.7% V5 (many diffs) n/a
Download CSV