Transcript: Human NM_001304792.1

Homo sapiens SUMO specific peptidase 6 (SENP6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-14
Taxon:
Homo sapiens (human)
Gene:
SENP6 (26054)
Length:
4025
CDS:
1017..3074

Additional Resources:

NCBI RefSeq record:
NM_001304792.1
NBCI Gene record:
SENP6 (26054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010850 TCGATCTGAAATTGTTGCTAA pLKO.1 1232 CDS 100% 4.950 6.930 N SENP6 n/a
2 TRCN0000004104 CACAGGATTAACAACCAAGAA pLKO.1 1796 CDS 100% 4.950 3.960 N SENP6 n/a
3 TRCN0000272838 CACAGGATTAACAACCAAGAA pLKO_005 1796 CDS 100% 4.950 3.960 N SENP6 n/a
4 TRCN0000272788 CCTTGATCCTCCGGCAAATAT pLKO_005 2657 CDS 100% 15.000 10.500 N SENP6 n/a
5 TRCN0000272839 TGAGTCTACTGGACCATTATT pLKO_005 1730 CDS 100% 15.000 10.500 N SENP6 n/a
6 TRCN0000004103 GACAGAACTAACAGAAGAGAA pLKO.1 2022 CDS 100% 4.950 3.465 N SENP6 n/a
7 TRCN0000293608 GACAGAACTAACAGAAGAGAA pLKO_005 2022 CDS 100% 4.950 3.465 N SENP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07981 pDONR223 100% 61.9% 61.9% None 606A>G;2055_2055delGins1261 n/a
2 ccsbBroad304_07981 pLX_304 0% 61.9% 61.9% V5 606A>G;2055_2055delGins1261 n/a
3 TRCN0000481041 CCACACCTATCACGACGTGAGGGG pLX_317 11.9% 61.9% 61.9% V5 606A>G;2055_2055delGins1261 n/a
Download CSV