Transcript: Human NM_001304811.1

Homo sapiens chromosome 12 open reading frame 4 (C12orf4), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
C12orf4 (57102)
Length:
3860
CDS:
118..1776

Additional Resources:

NCBI RefSeq record:
NM_001304811.1
NBCI Gene record:
C12orf4 (57102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134930 CGCAGGAGTAAATTGAAAGAA pLKO.1 1252 CDS 100% 5.625 7.875 N C12orf4 n/a
2 TRCN0000134101 CCCATGACATCACAACAATAA pLKO.1 1502 CDS 100% 13.200 9.240 N C12orf4 n/a
3 TRCN0000136680 GCTGGACTTCTGTAAGCATAA pLKO.1 1002 CDS 100% 10.800 7.560 N C12orf4 n/a
4 TRCN0000134843 CCACTCAAATTTCCTGTTCAA pLKO.1 208 CDS 100% 4.950 3.465 N C12orf4 n/a
5 TRCN0000134537 GCTCATCAACATTGTGACAAT pLKO.1 2508 3UTR 100% 4.950 3.465 N C12orf4 n/a
6 TRCN0000138019 GCTGGGAATCTGTCAAGCAAA pLKO.1 1839 3UTR 100% 4.950 3.465 N C12orf4 n/a
7 TRCN0000137468 GCTGTGAAATCAGGTGAAGTA pLKO.1 376 CDS 100% 4.950 3.465 N C12orf4 n/a
8 TRCN0000133910 CAAGAGTATCAAGAATGGGTA pLKO.1 778 CDS 100% 2.640 1.848 N C12orf4 n/a
9 TRCN0000133994 CGATTATGATAGAGATGCTGA pLKO.1 342 CDS 100% 2.640 1.848 N C12orf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03781 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03781 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474427 CCCATCTACTAGCATTGGGAGGTT pLX_317 19.2% 100% 100% V5 n/a
Download CSV