Transcript: Human NM_001305033.2

Homo sapiens zinc finger protein 33B (ZNF33B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF33B (7582)
Length:
5929
CDS:
68..2425

Additional Resources:

NCBI RefSeq record:
NM_001305033.2
NBCI Gene record:
ZNF33B (7582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014655 CCATTTAACATGGACGTAAGT pLKO.1 461 CDS 100% 4.950 3.960 N ZNF33B n/a
2 TRCN0000014654 CCGTAAATCAGACCTTGCTAA pLKO.1 2281 CDS 100% 4.950 3.465 N ZNF33B n/a
3 TRCN0000014653 GCCTTGTTCAACATTTGATAT pLKO.1 4921 3UTR 100% 13.200 7.920 N ZNF33B n/a
4 TRCN0000014657 CCCTCTCTCAACATTATAGAA pLKO.1 1788 CDS 100% 5.625 2.813 Y ZNF33B n/a
5 TRCN0000014656 CCCTCACATTACACCAGAGAA pLKO.1 1284 CDS 100% 4.950 2.475 Y ZNF33B n/a
6 TRCN0000164885 GCTGAGGCAGAAGAATCACTT pLKO.1 4534 3UTR 100% 4.950 2.475 Y FAM74A4 n/a
7 TRCN0000014952 CCTCCATAATGCCTCAGAGTA pLKO.1 2459 3UTR 100% 4.950 2.475 Y ZNF33A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11231 pDONR223 100% 91.2% 87.5% None (many diffs) n/a
2 ccsbBroad304_11231 pLX_304 0% 91.2% 87.5% V5 (many diffs) n/a
3 TRCN0000478493 CGGCATATTGCGATGCGTGTTATC pLX_317 13.3% 91.2% 87.5% V5 (many diffs) n/a
Download CSV