Transcript: Human NM_001305544.2

Homo sapiens ring finger protein 43 (RNF43), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
RNF43 (54894)
Length:
5495
CDS:
701..3052

Additional Resources:

NCBI RefSeq record:
NM_001305544.2
NBCI Gene record:
RNF43 (54894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004217 CCATGTGAGGATTGAGCTGAA pLKO.1 1246 CDS 100% 4.050 5.670 N RNF43 n/a
2 TRCN0000422519 ATCACAGAGGGAGATTCATTT pLKO_005 1646 CDS 100% 13.200 9.240 N RNF43 n/a
3 TRCN0000424439 GCAGAACAGAAAGCTATTATC pLKO_005 824 CDS 100% 13.200 9.240 N RNF43 n/a
4 TRCN0000424948 AGTGTGCTCCAGATGTGTTTG pLKO_005 3079 3UTR 100% 10.800 7.560 N RNF43 n/a
5 TRCN0000422812 ATGCCAGTGATGACGACAATC pLKO_005 975 CDS 100% 10.800 7.560 N RNF43 n/a
6 TRCN0000004219 GCAGAACGCATGACACCTTAT pLKO.1 3467 3UTR 100% 10.800 7.560 N RNF43 n/a
7 TRCN0000422557 TAGTGTACTGCAGCCCTAAAG pLKO_005 2223 CDS 100% 10.800 7.560 N RNF43 n/a
8 TRCN0000004218 CCACCTCCAATCCACCTCACA pLKO.1 1957 CDS 100% 0.880 0.616 N RNF43 n/a
9 TRCN0000010861 CTCCACCTCATTCGCCAGCAT pLKO.1 1715 CDS 100% 0.880 0.616 N RNF43 n/a
10 TRCN0000004216 GAAGGTGTGTTTGCTGGTGTT pLKO.1 896 CDS 100% 4.050 2.430 N RNF43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03475 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03475 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476170 CCAAAGGCGACAAGCGGTCCTCAC pLX_317 3.2% 100% 100% V5 n/a
Download CSV