Transcript: Mouse NM_001305988.1

Mus musculus canopy FGF signaling regulator 3 (Cnpy3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-23
Taxon:
Mus musculus (mouse)
Gene:
Cnpy3 (72029)
Length:
1784
CDS:
92..595

Additional Resources:

NCBI RefSeq record:
NM_001305988.1
NBCI Gene record:
Cnpy3 (72029)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200432 GAAGTGATTGACACCGGCTAT pLKO.1 302 CDS 100% 4.050 2.835 N Cnpy3 n/a
2 TRCN0000292707 GAAGTGATTGACACCGGCTAT pLKO_005 302 CDS 100% 4.050 2.835 N Cnpy3 n/a
3 TRCN0000200025 CCTTCCCTTGAACAACAGCAA pLKO.1 936 3UTR 100% 2.640 1.848 N Cnpy3 n/a
4 TRCN0000292708 CCTTCCCTTGAACAACAGCAA pLKO_005 936 3UTR 100% 2.640 1.848 N Cnpy3 n/a
5 TRCN0000182079 CAAGTACACCAAGTCGGACTT pLKO.1 352 CDS 100% 4.050 2.430 N Cnpy3 n/a
6 TRCN0000298040 CAAGTACACCAAGTCGGACTT pLKO_005 352 CDS 100% 4.050 2.430 N Cnpy3 n/a
7 TRCN0000163917 CCAGCAAATGCGAAGTGTGTA pLKO.1 228 CDS 100% 4.950 2.475 Y CNPY4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305988.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02510 pDONR223 100% 52.9% 54.3% None (many diffs) n/a
2 ccsbBroad304_02510 pLX_304 0% 52.9% 54.3% V5 (many diffs) n/a
3 TRCN0000474578 CGTCGATTGGCGGAGATGTTTTCT pLX_317 31.1% 52.9% 54.3% V5 (many diffs) n/a
Download CSV