Transcript: Mouse NM_001306217.1

Mus musculus trafficking protein particle complex 6B (Trappc6b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Trappc6b (78232)
Length:
1189
CDS:
237..602

Additional Resources:

NCBI RefSeq record:
NM_001306217.1
NBCI Gene record:
Trappc6b (78232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001306217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200933 CAGGACAACAAATTTCGACTA pLKO.1 519 CDS 100% 4.050 5.670 N Trappc6b n/a
2 TRCN0000192017 CCAATCAGAATAGTTTGTGTT pLKO.1 917 3UTR 100% 4.950 3.960 N Trappc6b n/a
3 TRCN0000192016 CCATAGGTGATTAGCATTTAA pLKO.1 839 3UTR 100% 15.000 10.500 N Trappc6b n/a
4 TRCN0000191438 CAAGGATGAATTAGACATCAT pLKO.1 410 CDS 100% 4.950 3.465 N Trappc6b n/a
5 TRCN0000201704 GATACTGCAAGGTTCAAGGAT pLKO.1 396 CDS 100% 3.000 2.100 N Trappc6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04763 pDONR223 100% 73.9% 64.1% None (many diffs) n/a
2 ccsbBroad304_04763 pLX_304 0% 73.9% 64.1% V5 (many diffs) n/a
3 TRCN0000480213 CGCTTCAGCCCCCTCAGAATTATC pLX_317 100% 73.9% 64.1% V5 (many diffs) n/a
Download CSV