Transcript: Human NM_001307960.1

Homo sapiens TM2 domain containing 3 (TM2D3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-23
Taxon:
Homo sapiens (human)
Gene:
TM2D3 (80213)
Length:
1282
CDS:
31..582

Additional Resources:

NCBI RefSeq record:
NM_001307960.1
NBCI Gene record:
TM2D3 (80213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001307960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142654 GTCCGAGCAATGGTTTGTGTA pLKO.1 155 CDS 100% 4.950 6.930 N TM2D3 n/a
2 TRCN0000432186 GTGTTGATCAAGACTTCAAAT pLKO_005 275 CDS 100% 13.200 9.240 N TM2D3 n/a
3 TRCN0000142015 GCAATTGGACTGGAGGCTATA pLKO.1 485 CDS 100% 10.800 7.560 N TM2D3 n/a
4 TRCN0000121943 CATTAACATGACTTGCAGATT pLKO.1 312 CDS 100% 4.950 3.465 N TM2D3 n/a
5 TRCN0000141902 GTGATGAAGTGTCCGAGCAAT pLKO.1 145 CDS 100% 4.950 3.465 N TM2D3 n/a
6 TRCN0000143609 GTGCAGTGAAACCATCTGTTA pLKO.1 251 CDS 100% 4.950 3.465 N TM2D3 n/a
7 TRCN0000122282 CAGACTGTATAGACTGCACAA pLKO.1 188 CDS 100% 4.050 2.835 N TM2D3 n/a
8 TRCN0000141203 CGAGCAATGGTTTGTGTAGCA pLKO.1 158 CDS 100% 2.640 1.848 N TM2D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001307960.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09014 pDONR223 100% 80.5% 72.7% None (many diffs) n/a
2 ccsbBroad304_09014 pLX_304 0% 80.5% 72.7% V5 (many diffs) n/a
3 TRCN0000471209 TAGAACCACACTTCCGCCCACACC pLX_317 67% 80.5% 72.7% V5 (many diffs) n/a
4 ccsbBroadEn_09015 pDONR223 100% 72.2% 65.3% None (many diffs) n/a
5 ccsbBroad304_09015 pLX_304 0% 72.2% 65.3% V5 (many diffs) n/a
6 TRCN0000471950 GCCGATTGCTAGAACATAATCTCC pLX_317 62.9% 72.2% 65.3% V5 (many diffs) n/a
Download CSV