Transcript: Human NM_001308031.1

Homo sapiens FER tyrosine kinase (FER), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
FER (2241)
Length:
10698
CDS:
56..1417

Additional Resources:

NCBI RefSeq record:
NM_001308031.1
NBCI Gene record:
FER (2241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194824 CAAACATTCCTCAACTTATAG pLKO.1 513 CDS 100% 13.200 9.240 N FER n/a
2 TRCN0000002350 GAGAGCAAGTAGAAAGAGGAT pLKO.1 1257 CDS 100% 2.640 1.848 N FER n/a
3 TRCN0000197121 GCACTGTCCAGAGGATATTTC pLKO.1 1297 CDS 100% 13.200 7.920 N FER n/a
4 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2207 3UTR 100% 4.950 2.475 Y ORAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14636 pDONR223 0% 53.2% 50.7% None (many diffs) n/a
2 ccsbBroad304_14636 pLX_304 0% 53.2% 50.7% V5 (many diffs) n/a
3 TRCN0000481126 AGGCTGTACATTGACAACTCCGAA pLX_317 17% 53.1% 50.6% V5 (many diffs) n/a
4 TRCN0000489132 AGAAAATTTGATATAATTGCCAAT pLX_317 13.3% 53.2% 50.7% V5 (many diffs) n/a
Download CSV