Transcript: Human NM_001308038.2

Homo sapiens FER tyrosine kinase (FER), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FER (2241)
Length:
1603
CDS:
345..836

Additional Resources:

NCBI RefSeq record:
NM_001308038.2
NBCI Gene record:
FER (2241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148090 TTATGTCAGCAACGTATCCA pXPR_003 AGG 202 41% 4 0.1043 FER FER 76800
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195272 CAGAACAACTTAGTAGGATAA pLKO.1 577 CDS 100% 10.800 15.120 N FER n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14636 pDONR223 0% 19.7% 19.5% None 482T>G;486_487insGAAACTGAA;489_490ins1968 n/a
2 ccsbBroad304_14636 pLX_304 0% 19.7% 19.5% V5 482T>G;486_487insGAAACTGAA;489_490ins1968 n/a
3 TRCN0000481126 AGGCTGTACATTGACAACTCCGAA pLX_317 17% 19.7% 19.5% V5 482T>G;486_487insGAAACTGAA;489_490ins1968 n/a
4 TRCN0000489132 AGAAAATTTGATATAATTGCCAAT pLX_317 13.3% 19.7% 19.5% V5 482T>G;486_487insGAAACTGAA;489_490ins1969 n/a
Download CSV