Transcript: Human NM_001308096.1

Homo sapiens glyoxylate reductase 1 homolog (GLYR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
GLYR1 (84656)
Length:
3725
CDS:
38..1681

Additional Resources:

NCBI RefSeq record:
NM_001308096.1
NBCI Gene record:
GLYR1 (84656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445414 GGAGCTTCATGGCCACTATTG pLKO_005 1353 CDS 100% 10.800 15.120 N GLYR1 n/a
2 TRCN0000416535 ACCAGACGTCATCCCACAATT pLKO_005 327 CDS 100% 13.200 10.560 N GLYR1 n/a
3 TRCN0000064672 CGCAAACTTAGCCTGTCTGAA pLKO.1 416 CDS 100% 4.950 3.960 N GLYR1 n/a
4 TRCN0000064669 CGCGGAAAGAAATGCTTCTTT pLKO.1 146 CDS 100% 0.563 0.450 N GLYR1 n/a
5 TRCN0000423858 GGACCAGTCTGACAACGATAT pLKO_005 1630 CDS 100% 10.800 7.560 N GLYR1 n/a
6 TRCN0000064671 GCAGCAAATGAGGTGTACAAA pLKO.1 1595 CDS 100% 5.625 3.938 N GLYR1 n/a
7 TRCN0000064668 CCAGGCAATCACGAAGAAGTT pLKO.1 733 CDS 100% 4.950 3.465 N GLYR1 n/a
8 TRCN0000064670 GCCTGATTTCTACCTGAAATA pLKO.1 1504 CDS 100% 1.320 0.924 N GLYR1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1946 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12837 pDONR223 100% 86.3% 86.4% None 1_207del;906_907insTGTGATTTGTTCATCCAG;1602T>C n/a
2 ccsbBroad304_12837 pLX_304 0% 86.3% 86.4% V5 1_207del;906_907insTGTGATTTGTTCATCCAG;1602T>C n/a
3 TRCN0000478521 CACCAGGACAGGTCCAATTAGTTT pLX_317 26.5% 86.3% 86.4% V5 1_207del;906_907insTGTGATTTGTTCATCCAG;1602T>C n/a
Download CSV