Construct: ORF TRCN0000478521
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015782.1_s317c1
- Derived from:
- ccsbBroadEn_12837
- DNA Barcode:
- CACCAGGACAGGTCCAATTAGTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GLYR1 (84656)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478521
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_011522717.2 | 99.9% | 100% | 1413T>C |
| 2 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_017023788.2 | 98.6% | 98.7% | 699_700insTGTGATTTGTTCATCCAG;1395T>C |
| 3 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_017023789.2 | 96.4% | 96.4% | 472_473ins51;1362T>C |
| 4 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_011522716.3 | 88.2% | 88.3% | 1_192del;1605T>C |
| 5 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NM_032569.4 | 87.4% | 87.5% | 1_207del;1620T>C |
| 6 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NM_001308096.1 | 86.3% | 86.4% | 1_207del;906_907insTGTGATTTGTTCATCCAG;1602T>C |
| 7 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NM_001324098.2 | 84.3% | 84.4% | 1_207del;679_680ins51;1569T>C |
| 8 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_017023786.2 | 80% | 80% | 1_357del;1167_1168insCTG;1767T>C |
| 9 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_017023787.2 | 76.3% | 76.4% | (many diffs) |
| 10 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NM_001324097.2 | 72.8% | 72.8% | 1_207del;292_293ins243;1377T>C |
| 11 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NM_001324096.2 | 71.7% | 71.7% | (many diffs) |
| 12 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XM_005255639.5 | 63.9% | 64% | (many diffs) |
| 13 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XR_001752010.2 | 47.3% | 1_974del;1785_1901del;2294_2295ins249 | |
| 14 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NR_136697.1 | 42.1% | 1_330del;1743T>C;1783_3445del | |
| 15 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NR_136696.1 | 41.5% | (many diffs) | |
| 16 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NR_136695.2 | 40.9% | 1_429del;1842T>C;1882_3544del | |
| 17 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NR_136699.1 | 40.6% | (many diffs) | |
| 18 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NR_136698.1 | 40.1% | (many diffs) | |
| 19 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XR_002957846.1 | 37.7% | (many diffs) | |
| 20 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | NR_136700.1 | 35.5% | (many diffs) | |
| 21 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XR_001752009.2 | 33.4% | (many diffs) | |
| 22 | human | 84656 | GLYR1 | glyoxylate reductase 1 homolog | XR_001752008.2 | 30.7% | (many diffs) | |
| 23 | mouse | 74022 | Glyr1 | glyoxylate reductase 1 homo... | XM_006522642.3 | 92.5% | 98.3% | (many diffs) |
| 24 | mouse | 74022 | Glyr1 | glyoxylate reductase 1 homo... | XM_017317142.1 | 91.3% | 97.1% | (many diffs) |
| 25 | mouse | 74022 | Glyr1 | glyoxylate reductase 1 homo... | NM_001079814.1 | 81% | 86% | (many diffs) |
| 26 | mouse | 74022 | Glyr1 | glyoxylate reductase 1 homo... | NM_028720.2 | 79.9% | 84.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1518
- ORF length:
- 1452
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat aaaaattaac aagggtaaac gattccagca agcggtagat gctgtcgaag 121 agttcctcag gagagccaaa gggaaagacc agacgtcatc ccacaattct tctgatgaca 181 agaatcgacg taattccagt gaggagagaa gtaggccaaa ctcaggtgat gagaagcgca 241 aacttagcct gtctgaaggg aaggtgaaga agaacatggg agaaggaaag aagagggtgt 301 cttcaggctc ttcagagaga ggctccaaat cccctctgaa aagagcccaa gagcaaagtc 361 cccggaagcg gggtcggccc ccaaaggatg agaaggatct caccatcccg gagtctagta 421 ccgtgaaggg gatgatggcc ggaccgatgg ccgcgtttaa atggcagcca accgcaagcg 481 agcctgttaa agatgcagat cctcatttcc atcatttcct gctaagccaa acagagaagc 541 cagctgtctg ttaccaggca atcacgaaga agttgaaaat atgtgaagag gaaactggct 601 ccacctccat ccaggcagct gacagcacag ccgtgaatgg cagcatcaca cccacagaca 661 aaaagatagg atttttgggc cttggtctca tgggaagtgg aatcgtctcc aacttgctaa 721 aaatgggtca cacagtgact gtctggaacc gcactgcaga gaaatgtgat ttgttcatcc 781 aggagggggc ccgtctggga agaacccccg ctgaagtcgt ctcaacctgc gacatcactt 841 tcgcctgcgt gtcggatccc aaggcggcca aggacctggt gctgggcccc agtggtgtgc 901 tgcaagggat ccgccctggg aagtgctacg tggacatgtc aacagtggac gctgacaccg 961 tcactgagct ggcccaggtg attgtgtcca ggggggggcg ctttctggaa gcccccgtct 1021 cagggaatca gcagctgtct aatgacggga tgttggtgat cttagcggct ggagacaggg 1081 gcttatatga ggactgcagc agctgcttcc aggcgatggg gaagacctcc ttcttccTAG 1141 GTGAAGTGGG CAATGCAGCC AAGATGATGC TGATCGTGAA CATGGTCCAA GGGAGCTTCA 1201 TGGCCACTAT TGCCGAGGGG CTGACCCTGG CCCAGGTGAC AGGCCAGTCC CAGCAGACAC 1261 TCTTGGACAT CCTCAATCAG GGACAGTTGG CCAGCATCTT CCTGGACCAG AAGTGCCAAA 1321 ATATCCTGCA AGGAAACTTT AAGCCTGATT TCTACCTGAA ATACATTCAG AAGGATCTCC 1381 GCTTAGCCAT TGCGCTGGGT GATGCGGTCA ACCATCCGAC TCCCATGGCA GCTGCAGCAA 1441 ATGAGGTGTA CAAAAGAGCC AAGGCGCTGG ACCAGTCCGA CAACGATATG TCCGCCGTGT 1501 ACCGAGCCTA CATACACTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1561 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1621 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACACCAGG ACAGGTCCAA 1681 TTAGTTTACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt