Transcript: Mouse NM_001308474.1

Mus musculus porcupine homolog (Drosophila) (Porcn), transcript variant e, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Porcn (53627)
Length:
1361
CDS:
348..1031

Additional Resources:

NCBI RefSeq record:
NM_001308474.1
NBCI Gene record:
Porcn (53627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001308474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345607 CCATGTCTTATTGGTTAAATA pLKO_005 568 CDS 100% 15.000 21.000 N Porcn n/a
2 TRCN0000093492 CCCATGTCTTATTGGTTAAAT pLKO.1 567 CDS 100% 15.000 21.000 N Porcn n/a
3 TRCN0000093490 GCCCATGTCTTATTGGTTAAA pLKO.1 566 CDS 100% 13.200 18.480 N Porcn n/a
4 TRCN0000329194 CAGTCTCTAGACCGTTGAATG pLKO_005 499 CDS 100% 10.800 15.120 N Porcn n/a
5 TRCN0000345539 GGATCTTCTACCGTCTCATAG pLKO_005 1006 CDS 100% 10.800 15.120 N Porcn n/a
6 TRCN0000440483 ACACCGTGACATGGCACAAGA pLKO_005 338 5UTR 100% 4.950 3.960 N PORCN n/a
7 TRCN0000093491 CGAGCCTTAAACTTGCTCTTT pLKO.1 831 CDS 100% 4.950 3.960 N Porcn n/a
8 TRCN0000153848 CCTTCCACTTCAGCAACTATT pLKO.1 394 CDS 100% 13.200 9.240 N PORCN n/a
9 TRCN0000345609 CCTTCCACTTCAGCAACTATT pLKO_005 394 CDS 100% 13.200 9.240 N Porcn n/a
10 TRCN0000151700 CTTCCACTTCAGCAACTATTT pLKO.1 395 CDS 100% 13.200 9.240 N PORCN n/a
11 TRCN0000329124 CTTCCACTTCAGCAACTATTT pLKO_005 395 CDS 100% 13.200 9.240 N Porcn n/a
12 TRCN0000345608 AGTGCCTGCATCTTGTCAAAG pLKO_005 762 CDS 100% 10.800 7.560 N Porcn n/a
13 TRCN0000329127 GAACACACACAACTTTCTATG pLKO_005 1167 3UTR 100% 10.800 7.560 N Porcn n/a
14 TRCN0000329196 TGCCCATGTCTTATTGGTTAA pLKO_005 565 CDS 100% 10.800 7.560 N Porcn n/a
15 TRCN0000353210 AGACCCTTTCTCTACTCCTTT pLKO_005 1101 3UTR 100% 4.950 3.465 N Porcn n/a
16 TRCN0000093489 CAACTTTCTATGCCTGTCAAT pLKO.1 1176 3UTR 100% 4.950 3.465 N Porcn n/a
17 TRCN0000157366 CTGGATCTTCTACCGTCTCAT pLKO.1 1004 CDS 100% 4.950 3.465 N PORCN n/a
18 TRCN0000093493 GCTGCTTCTTACCATCTGCTT pLKO.1 274 5UTR 100% 2.640 1.584 N Porcn n/a
19 TRCN0000153546 CTGTTTGATGTCGATGTGGAT pLKO.1 891 CDS 100% 2.640 1.848 N PORCN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03976 pDONR223 100% 45.9% 47.5% None (many diffs) n/a
2 ccsbBroad304_03976 pLX_304 0% 45.9% 47.5% V5 (many diffs) n/a
3 TRCN0000471066 CCGTCCCAGTATAAATTCTCAATG pLX_317 29.7% 45.9% 47.5% V5 (many diffs) n/a
Download CSV