Transcript: Mouse NM_001308486.1

Mus musculus CDK5 regulatory subunit associated protein 1-like 1 (Cdkal1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdkal1 (68916)
Length:
2437
CDS:
156..566

Additional Resources:

NCBI RefSeq record:
NM_001308486.1
NBCI Gene record:
Cdkal1 (68916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001308486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173270 CCTAAAGTACGAAGGCGGAAT pLKO.1 261 CDS 100% 4.050 5.670 N Cdkal1 n/a
2 TRCN0000217277 CTTGCTGCCTATGGCTATAAA pLKO.1 411 CDS 100% 15.000 10.500 N Cdkal1 n/a
3 TRCN0000194337 CCACCAAGTGACAGCACTATT pLKO.1 312 CDS 100% 13.200 9.240 N Cdkal1 n/a
4 TRCN0000340530 GCTTGCTGCCTATGGCTATAA pLKO_005 410 CDS 100% 13.200 7.920 N Cdkal1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308486.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14174 pDONR223 100% 60.3% 1.9% None (many diffs) n/a
2 ccsbBroad304_14174 pLX_304 0% 60.3% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468296 GAAAAGTAAGGACTTAGACTTGGT pLX_317 100% 60.3% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV