Transcript: Mouse NM_001310070.1

Mus musculus activating transcription factor 7 (Atf7), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Atf7 (223922)
Length:
1848
CDS:
448..1722

Additional Resources:

NCBI RefSeq record:
NM_001310070.1
NBCI Gene record:
Atf7 (223922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434189 TATACCTGGCCCACCGGTTAA pLKO_005 1146 CDS 100% 10.800 7.560 N Atf7 n/a
2 TRCN0000086247 CAGTCATCATTGCAGATCAAA pLKO.1 578 CDS 100% 5.625 3.938 N Atf7 n/a
3 TRCN0000086244 CCATCAAGTTTCTTCAATCAA pLKO.1 1242 CDS 100% 5.625 3.938 N Atf7 n/a
4 TRCN0000017117 GAAGTCACATTACTACGCAAT pLKO.1 1576 CDS 100% 4.050 2.835 N ATF7 n/a
5 TRCN0000086245 GCAGTTCATAAACATAAGCAT pLKO.1 520 CDS 100% 3.000 2.100 N Atf7 n/a
6 TRCN0000086246 GCAGCTACTGTTAGCTCATAA pLKO.1 1614 CDS 100% 1.320 0.924 N Atf7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15736 pDONR223 0% 24.7% 18.9% None (many diffs) n/a
2 ccsbBroad304_15736 pLX_304 0% 24.7% 18.9% V5 (many diffs) n/a
3 TRCN0000492204 CCGAACACCCTCTAACTCGGCCTC pLX_317 100% 24.7% 18.9% V5 (many diffs) n/a
Download CSV