Transcript: Mouse NM_001310540.1

Mus musculus tripeptidyl peptidase II (Tpp2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tpp2 (22019)
Length:
4669
CDS:
96..3845

Additional Resources:

NCBI RefSeq record:
NM_001310540.1
NBCI Gene record:
Tpp2 (22019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263385 CAAACGCTACGCCCAGTAAAT pLKO_005 2478 CDS 100% 13.200 18.480 N Tpp2 n/a
2 TRCN0000032852 GCTTGATTCTACTGACATTTA pLKO.1 3200 CDS 100% 13.200 18.480 N Tpp2 n/a
3 TRCN0000263386 TGAATCAGTGTCGGCACATAA pLKO_005 1861 CDS 100% 13.200 18.480 N Tpp2 n/a
4 TRCN0000032849 GCAGGTTACAACTGATGGAAA pLKO.1 257 CDS 100% 4.950 3.960 N Tpp2 n/a
5 TRCN0000263387 GCCTGATGCAGCTACTATAAA pLKO_005 3404 CDS 100% 15.000 10.500 N Tpp2 n/a
6 TRCN0000032850 GCCAAATAATCGCCAGCTTTA pLKO.1 2534 CDS 100% 10.800 7.560 N Tpp2 n/a
7 TRCN0000263384 TTGAGTAAATGTGCCGTATTG pLKO_005 747 CDS 100% 10.800 7.560 N Tpp2 n/a
8 TRCN0000032851 CCATCATGTATCCTCCTGATT pLKO.1 3811 CDS 100% 4.950 3.465 N Tpp2 n/a
9 TRCN0000032853 GCCAATAAACTAATCAAGGAA pLKO.1 591 CDS 100% 3.000 2.100 N Tpp2 n/a
10 TRCN0000263383 ACCATTCAATACTGATCATTA pLKO_005 3950 3UTR 100% 13.200 7.920 N Tpp2 n/a
11 TRCN0000051396 CCTGTATATGACTGCTTGGTA pLKO.1 672 CDS 100% 3.000 2.100 N TPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07095 pDONR223 100% 90.4% 96.3% None (many diffs) n/a
2 ccsbBroad304_07095 pLX_304 0% 90.4% 96.3% V5 (many diffs) n/a
3 TRCN0000474567 GTCTACCCTCTACGCCCCATACAC pLX_317 10.8% 90.4% 96.3% V5 (many diffs) n/a
Download CSV