Transcript: Mouse NM_001310710.1

Mus musculus solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8 (Slc17a8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Slc17a8 (216227)
Length:
3854
CDS:
305..1558

Additional Resources:

NCBI RefSeq record:
NM_001310710.1
NBCI Gene record:
Slc17a8 (216227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079875 CCATACCAAAGGAGTGGCTAT pLKO.1 1021 CDS 100% 4.050 5.670 N Slc17a8 n/a
2 TRCN0000079876 CCTGATAAGTCAGCCAGCTTA pLKO.1 790 CDS 100% 4.950 3.465 N Slc17a8 n/a
3 TRCN0000079873 CCTTCTTACAAAGATGGGAAT pLKO.1 1687 3UTR 100% 4.050 2.835 N Slc17a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05283 pDONR223 100% 54.4% 57.2% None (many diffs) n/a
2 ccsbBroad304_05283 pLX_304 0% 54.4% 57.2% V5 (many diffs) n/a
3 TRCN0000473415 TGCGATAGCCCATGGCGGTGGTCG pLX_317 19% 54.4% 57.2% V5 (many diffs) n/a
Download CSV