Transcript: Mouse NM_001311108.1

Mus musculus transmembrane and coiled-coil domains 2 (Tmcc2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tmcc2 (68875)
Length:
2860
CDS:
225..1640

Additional Resources:

NCBI RefSeq record:
NM_001311108.1
NBCI Gene record:
Tmcc2 (68875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124365 CCGAGATCCAACACTCTTTAT pLKO.1 1020 CDS 100% 13.200 18.480 N Tmcc2 n/a
2 TRCN0000425114 AGGATGCTCTAGTCATGTAAG pLKO_005 1938 3UTR 100% 10.800 15.120 N Tmcc2 n/a
3 TRCN0000445284 CAAGGATGTGCTACGCGATAT pLKO_005 629 CDS 100% 10.800 15.120 N Tmcc2 n/a
4 TRCN0000124364 CCAGGGCTGCATTATTTGAAT pLKO.1 1879 3UTR 100% 5.625 4.500 N Tmcc2 n/a
5 TRCN0000124366 CCAGCGAACTAAGGCTGCCAT pLKO.1 356 CDS 100% 0.880 0.704 N Tmcc2 n/a
6 TRCN0000434037 AGGGACACTCTCAGCCAAATG pLKO_005 1842 3UTR 100% 10.800 7.560 N Tmcc2 n/a
7 TRCN0000438436 CCATGGAGATGGTCTGGATAA pLKO_005 2030 3UTR 100% 10.800 7.560 N Tmcc2 n/a
8 TRCN0000423231 AGATCACTGAGCAGATCAAGA pLKO_005 403 CDS 100% 4.950 3.465 N Tmcc2 n/a
9 TRCN0000124367 CCAGAATGAAATGACCAACCT pLKO.1 1238 CDS 100% 2.640 1.848 N Tmcc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07509 pDONR223 100% 58.1% 63.4% None (many diffs) n/a
2 ccsbBroad304_07509 pLX_304 0% 58.1% 63.4% V5 (many diffs) n/a
Download CSV