Transcript: Mouse NM_001311123.1

Mus musculus transient receptor potential cation channel, subfamily C, member 1 (Trpc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Trpc1 (22063)
Length:
4472
CDS:
472..2799

Additional Resources:

NCBI RefSeq record:
NM_001311123.1
NBCI Gene record:
Trpc1 (22063)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311244 ATTCATGGAGCATCGTATTTC pLKO_005 1582 CDS 100% 13.200 18.480 N Trpc1 n/a
2 TRCN0000070033 CCGAAATGAAATAAGGGATTT pLKO.1 2730 CDS 100% 10.800 15.120 N Trpc1 n/a
3 TRCN0000044000 GCTCATCGTAACAACTATGAA pLKO.1 916 CDS 100% 5.625 7.875 N TRPC1 n/a
4 TRCN0000291283 GCTCATCGTAACAACTATGAA pLKO_005 916 CDS 100% 5.625 7.875 N TRPC1 n/a
5 TRCN0000043998 GCCCACCTGTAAGAAGATAAT pLKO.1 1452 CDS 100% 13.200 10.560 N TRPC1 n/a
6 TRCN0000291284 GCCCACCTGTAAGAAGATAAT pLKO_005 1452 CDS 100% 13.200 10.560 N TRPC1 n/a
7 TRCN0000070037 GCTAAAGATTTGCTCGCACAA pLKO.1 1222 CDS 100% 4.050 3.240 N Trpc1 n/a
8 TRCN0000303221 GCTAAAGATTTGCTCGCACAA pLKO_005 1222 CDS 100% 4.050 3.240 N Trpc1 n/a
9 TRCN0000296826 TGCGACAAGGGTGACTATTAT pLKO_005 682 CDS 100% 15.000 10.500 N TRPC1 n/a
10 TRCN0000305058 TGCGACAAGGGTGACTATTAT pLKO_005 682 CDS 100% 15.000 10.500 N Trpc1 n/a
11 TRCN0000305006 GGTTTCGTCTTGATATCTATA pLKO_005 1049 CDS 100% 13.200 9.240 N Trpc1 n/a
12 TRCN0000043999 GCTACTTTGATGACAAATGTA pLKO.1 2426 CDS 100% 5.625 3.938 N TRPC1 n/a
13 TRCN0000070034 GCCATCTTTGTCACCAGGTTT pLKO.1 2230 CDS 100% 4.950 3.465 N Trpc1 n/a
14 TRCN0000070035 CCAGTCAAATTGCCAGCAGTT pLKO.1 1386 CDS 100% 4.050 2.835 N Trpc1 n/a
15 TRCN0000070036 GCTATTTGATAGCTCCCAAAT pLKO.1 1517 CDS 100% 1.080 0.756 N Trpc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01713 pDONR223 100% 88.9% 97.6% None (many diffs) n/a
2 ccsbBroad304_01713 pLX_304 0% 88.9% 97.6% V5 (many diffs) n/a
3 TRCN0000468696 TTCATTGTTAAATCCATGTTCTCC pLX_317 18.6% 88.9% 97.6% V5 (many diffs) n/a
Download CSV