Transcript: Mouse NM_001311136.1

Mus musculus kelch-like 12 (Klhl12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Klhl12 (240756)
Length:
3281
CDS:
142..1848

Additional Resources:

NCBI RefSeq record:
NM_001311136.1
NBCI Gene record:
Klhl12 (240756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108921 CGGTGGAATGTCTAGACTATA pLKO.1 1175 CDS 100% 13.200 10.560 N Klhl12 n/a
2 TRCN0000108920 GCACTTTCTTACTGTTTCTAA pLKO.1 2119 3UTR 100% 5.625 3.938 N Klhl12 n/a
3 TRCN0000108923 GCCTGCTGTGAGTTCTTAGAA pLKO.1 502 CDS 100% 5.625 3.938 N Klhl12 n/a
4 TRCN0000108924 GCTGAGCAGCATTGAGTGTTA pLKO.1 1740 CDS 100% 4.950 3.465 N Klhl12 n/a
5 TRCN0000108922 CCCAGGTACATTACAGATGTA pLKO.1 826 CDS 100% 0.495 0.347 N Klhl12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311136.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08787 pDONR223 100% 91.3% 99.2% None (many diffs) n/a
2 ccsbBroad304_08787 pLX_304 0% 91.3% 99.2% V5 (many diffs) n/a
3 TRCN0000471185 CATTTGACGTCAGCAGCGCAACTT pLX_317 23.2% 91.3% 99.2% V5 (many diffs) n/a
Download CSV