Transcript: Mouse NM_001312900.1

Mus musculus glutamate decarboxylase 1 (Gad1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Gad1 (14415)
Length:
1605
CDS:
269..940

Additional Resources:

NCBI RefSeq record:
NM_001312900.1
NBCI Gene record:
Gad1 (14415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001312900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106447 GCCCTACAACGTATGATACTT pLKO.1 339 CDS 100% 5.625 7.875 N Gad1 n/a
2 TRCN0000106446 GTAGACATACTCCTCAACTAT pLKO.1 626 CDS 100% 5.625 7.875 N Gad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00608 pDONR223 100% 90.4% 96.8% None (many diffs) n/a
2 ccsbBroad304_00608 pLX_304 0% 90.4% 96.8% V5 (many diffs) n/a
3 TRCN0000470971 GAAAATGGTGAAGAGCAAACAACA pLX_317 66% 90.4% 96.8% V5 (many diffs) n/a
4 ccsbBroadEn_06248 pDONR223 100% 33.6% 34.8% None (many diffs) n/a
5 ccsbBroad304_06248 pLX_304 0% 33.6% 34.8% V5 (many diffs) n/a
6 TRCN0000479088 GTCCCTGGAGGACGGGATCCCCTT pLX_317 20.2% 33.6% 34.8% V5 (many diffs) n/a
7 ccsbBroadEn_00609 pDONR223 100% 33.6% 34.8% None (many diffs) n/a
8 ccsbBroad304_00609 pLX_304 0% 33.6% 34.8% V5 (many diffs) n/a
9 TRCN0000467890 CACATGTACAGATACATGGTTATT pLX_317 25.4% 33.6% 34.8% V5 (many diffs) n/a
Download CSV