Transcript: Human NM_001312919.2

Homo sapiens Myb/SANT DNA binding domain containing 2 (MSANTD2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MSANTD2 (79684)
Length:
2128
CDS:
27..566

Additional Resources:

NCBI RefSeq record:
NM_001312919.2
NBCI Gene record:
MSANTD2 (79684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001312919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432897 ATATCACCCTTAGCTACTATT pLKO_005 1947 3UTR 100% 13.200 18.480 N MSANTD2 n/a
2 TRCN0000017121 CCTGTCACAAAGAGAACATTA pLKO.1 545 CDS 100% 13.200 18.480 N MSANTD2 n/a
3 TRCN0000423782 ACTCTACAGCAGTGCTTATTT pLKO_005 1220 3UTR 100% 15.000 12.000 N MSANTD2 n/a
4 TRCN0000433875 TTTGAGCAAGCAAGATATATA pLKO_005 1646 3UTR 100% 15.000 10.500 N MSANTD2 n/a
5 TRCN0000415252 AGCCTGAAGGACGGATCATTA pLKO_005 828 3UTR 100% 13.200 9.240 N MSANTD2 n/a
6 TRCN0000017118 GCCTCATTACAGGTGGAAATA pLKO.1 1151 3UTR 100% 13.200 9.240 N MSANTD2 n/a
7 TRCN0000017120 CCATTGGCTATGAAGAATGTA pLKO.1 1041 3UTR 100% 5.625 3.938 N MSANTD2 n/a
8 TRCN0000017122 CCCAAATCCATCTACATCAAA pLKO.1 1337 3UTR 100% 5.625 3.938 N MSANTD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001312919.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14266 pDONR223 100% 31.3% 30.9% None (many diffs) n/a
2 ccsbBroad304_14266 pLX_304 0% 31.3% 30.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475954 TCCGCCCATTTTGTACGGACGAGC pLX_317 6.4% 31.3% 30.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV