Transcript: Mouse NM_001313742.1

Mus musculus histone deacetylase 8 (Hdac8), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hdac8 (70315)
Length:
2195
CDS:
95..856

Additional Resources:

NCBI RefSeq record:
NM_001313742.1
NBCI Gene record:
Hdac8 (70315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088001 GTGGATTTGGATCTACACCAT pLKO.1 617 CDS 100% 2.640 3.696 N Hdac8 n/a
2 TRCN0000088002 CCATAGAATATGGACTAGGTT pLKO.1 372 CDS 100% 3.000 2.400 N Hdac8 n/a
3 TRCN0000314874 TTACGATTGCGACGGAAATTT pLKO_005 581 CDS 100% 15.000 10.500 N HDAC8 n/a
4 TRCN0000087999 CTACAGTGTCAATGTGCCCAT pLKO.1 766 CDS 100% 2.160 1.512 N Hdac8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08602 pDONR223 100% 59.2% 62.3% None (many diffs) n/a
2 ccsbBroad304_08602 pLX_304 0% 59.2% 62.3% V5 (many diffs) n/a
3 TRCN0000467791 AACTATTCCCAAGCGGCTCTCGTG pLX_317 32.5% 59.2% 62.3% V5 (many diffs) n/a
Download CSV