Construct: ORF TRCN0000467791
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010798.1_s317c1
- Derived from:
- ccsbBroadEn_08602
- DNA Barcode:
- AACTATTCCCAAGCGGCTCTCGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HDAC8 (55869)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467791
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55869 | HDAC8 | histone deacetylase 8 | NM_018486.3 | 99.8% | 99.7% | 92T>C;159G>A |
| 2 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_011530986.3 | 93.3% | 93% | 92T>C;159G>A;1112_1189del |
| 3 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029641.2 | 92.9% | 92.8% | 92T>C;159G>A;549_550ins78 |
| 4 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029640.2 | 86.9% | 86.6% | (many diffs) |
| 5 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_002958779.1 | 84.4% | (many diffs) | |
| 6 | human | 55869 | HDAC8 | histone deacetylase 8 | NM_001166418.2 | 75.6% | 75.5% | 92T>C;159G>A;164_165ins273 |
| 7 | human | 55869 | HDAC8 | histone deacetylase 8 | NM_001166419.2 | 66.8% | 65.4% | (many diffs) |
| 8 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029645.2 | 66.5% | 66.2% | (many diffs) |
| 9 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029642.1 | 64.7% | 64.3% | (many diffs) |
| 10 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_002958780.1 | 64% | (many diffs) | |
| 11 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029643.2 | 62.6% | 62.1% | (many diffs) |
| 12 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_938402.3 | 62% | (many diffs) | |
| 13 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029646.1 | 61.5% | 61.2% | 0_1ins387;725_802del |
| 14 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029647.2 | 59.9% | 58.5% | (many diffs) |
| 15 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_017029644.2 | 58.8% | 58.5% | (many diffs) |
| 16 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_001755711.2 | 57.7% | (many diffs) | |
| 17 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_002958781.1 | 57.5% | (many diffs) | |
| 18 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_002958783.1 | 56.8% | (many diffs) | |
| 19 | human | 55869 | HDAC8 | histone deacetylase 8 | NR_051952.2 | 56.2% | (many diffs) | |
| 20 | human | 55869 | HDAC8 | histone deacetylase 8 | XM_024452405.1 | 45.1% | 44.9% | 0_1ins585;527_604del |
| 21 | human | 55869 | HDAC8 | histone deacetylase 8 | NM_001166422.2 | 41.3% | 39.2% | (many diffs) |
| 22 | human | 55869 | HDAC8 | histone deacetylase 8 | NM_001166420.1 | 38.4% | 38.4% | 92T>C;159G>A;438_438delGins694 |
| 23 | human | 55869 | HDAC8 | histone deacetylase 8 | NM_001166448.2 | 35.8% | 34.5% | (many diffs) |
| 24 | human | 55869 | HDAC8 | histone deacetylase 8 | XR_002958782.1 | 21.8% | (many diffs) | |
| 25 | mouse | 70315 | Hdac8 | histone deacetylase 8 | NM_027382.4 | 90.8% | 96% | (many diffs) |
| 26 | mouse | 70315 | Hdac8 | histone deacetylase 8 | XM_006528275.3 | 87.9% | 92.2% | (many diffs) |
| 27 | mouse | 70315 | Hdac8 | histone deacetylase 8 | XM_011247670.2 | 82.2% | 85.6% | (many diffs) |
| 28 | mouse | 70315 | Hdac8 | histone deacetylase 8 | XM_006528276.3 | 80.2% | 84.8% | (many diffs) |
| 29 | mouse | 70315 | Hdac8 | histone deacetylase 8 | XM_011247671.2 | 80.1% | 84.8% | (many diffs) |
| 30 | mouse | 70315 | Hdac8 | histone deacetylase 8 | NM_001313742.1 | 59.2% | 62.3% | (many diffs) |
| 31 | mouse | 70315 | Hdac8 | histone deacetylase 8 | XM_011247673.2 | 37.5% | 36.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagccggag gaaccggcgg acagtgggca gtcgctggtc ccggtttata 121 tctatagtcc cgagtatgtc agtatgtgtg actccccggc caagatcccc aaacgggcca 181 gtatggtgca ttctttgatt gaagcatatg cactgcataa gcaaatgagg atagttaagc 241 ctaaagtggc ctccatggag gagatggcca ccttccacac tgatgcttat ctgcagcatc 301 tccagaaggt cagccaagag ggcgatgatg atcatccgga ctccatagaa tatgggctag 361 gttatgactg cccagccact gaagggatat ttgactatgc agcagctata ggaggggcta 421 cgatcacagc tgcccaatgc ctgattgacg gaatgtgcaa agtagcaatt aactggtctg 481 gagggtggca tcatgcaaag aaagatgaag catctggttt ttgttatctc aatgatgctg 541 tcctgggaat attacgattg cgacggaaat ttgagcgtat tctctacgtg gatttggatc 601 tgcaccatgg agatggtgta gaagacgcat tcagtttcac ctccaaagtc atgaccgtgt 661 ccctgcacaa attctcccca ggatttttcc caggaacagg tgacgtgtct gatgttggcc 721 tagggaaggg acggtactac agtgtaaatg tgcccattca ggatggcata caagatgaaa 781 aatattacca gatctgtgaa agtgtactaa aggaagtata ccaagccttt aaTCCCAAAG 841 CAGTGGTCTT ACAGCTGGGA GCTGACACAA TAGCTGGGGA TCCCATGTGC TCCTTTAACA 901 TGACTCCAGT GGGAATTGGC AAGTGTCTTA AGTACATCCT TCAATGGCAG TTGGCAACAC 961 TCATTTTGGG AGGAGGAGGC TATAACCTTG CCAACACGGC TCGATGCTGG ACATACTTGA 1021 CCGGGGTCAT CCTAGGGAAA ACACTATCCT CTGAGATCCC AGATCATGAG TTTTTCACAG 1081 CATATGGTCC TGATTATGTG CTGGAAATCA CGCCAAGCTG CCGGCCAGAC CGCAATGAGC 1141 CCCACCGAAT CCAACAAATC CTCAACTACA TCAAAGGGAA TCTGAAGCAT GTGGTCTACC 1201 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1261 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1321 ATATATCTTG TGGAAAGGAC GAAACTATTC CCAAGCGGCT CTCGTGACGC GTTAAGTCga 1381 caatcaacct ctggattaca aaatttgtga aagatt