Transcript: Mouse NM_001313897.1

Mus musculus leukotriene A4 hydrolase (Lta4h), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lta4h (16993)
Length:
1983
CDS:
115..1713

Additional Resources:

NCBI RefSeq record:
NM_001313897.1
NBCI Gene record:
Lta4h (16993)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313897.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031096 GCTTCCTATATTCCCACTTTA pLKO.1 1394 CDS 100% 13.200 18.480 N Lta4h n/a
2 TRCN0000031095 CGAAGGACATACTGTCTACTT pLKO.1 1068 CDS 100% 4.950 6.930 N Lta4h n/a
3 TRCN0000031097 GCTTTGGTTGTTGGAGCTTTA pLKO.1 724 CDS 100% 10.800 7.560 N Lta4h n/a
4 TRCN0000031094 GCAGACAAATTGGCCCAAGAA pLKO.1 749 CDS 100% 4.950 3.465 N Lta4h n/a
5 TRCN0000031098 CCCTTGGAGAAAGTCAAGGTT pLKO.1 338 CDS 100% 0.300 0.180 N Lta4h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313897.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13893 pDONR223 100% 75.7% 2.2% None (many diffs) n/a
2 ccsbBroad304_13893 pLX_304 0% 75.7% 2.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475354 TACTCCGAAAGATCATGAAACGCC pLX_317 22% 75.7% 2.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV