Transcript: Mouse NM_001313928.1

Mus musculus corticotropin releasing hormone receptor 1 (Crhr1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Crhr1 (12921)
Length:
2431
CDS:
292..1419

Additional Resources:

NCBI RefSeq record:
NM_001313928.1
NBCI Gene record:
Crhr1 (12921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313928.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026348 CCTACAACTACTTCCACGTAA pLKO.1 752 CDS 100% 4.950 6.930 N Crhr1 n/a
2 TRCN0000026371 CCTGCTGATCAACTTTATCTT pLKO.1 1008 CDS 100% 5.625 3.938 N Crhr1 n/a
3 TRCN0000026350 CGTGTCTGTGTTCTATTGTTT pLKO.1 1245 CDS 100% 5.625 3.938 N Crhr1 n/a
4 TRCN0000026341 CTACCACATTGCCGTCATCAT pLKO.1 516 CDS 100% 4.950 3.465 N Crhr1 n/a
5 TRCN0000356857 TCCTGGTCCTGCTGATCAATT pLKO_005 1001 CDS 100% 13.200 9.240 N CRHR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313928.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489110 ATCCGTGTTTTGCTAGACCATCTC pLX_317 29.7% 82.2% 87.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489626 TTGCTAGTATCTTCGAGTTCCGGG pLX_317 28.1% 82.1% 87.5% V5 (many diffs) n/a
Download CSV