Transcript: Mouse NM_001313981.1

Mus musculus transcription factor 7, T cell specific (Tcf7), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Tcf7 (21414)
Length:
2695
CDS:
184..1095

Additional Resources:

NCBI RefSeq record:
NM_001313981.1
NBCI Gene record:
Tcf7 (21414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001313981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012678 GCCACAAGTCTAAACAATAAT pLKO.1 1744 3UTR 100% 15.000 21.000 N Tcf7 n/a
2 TRCN0000262741 AGAAATGCATTCGGTACTTAC pLKO_005 1024 CDS 100% 10.800 15.120 N Tcf7 n/a
3 TRCN0000262743 AGTCAATATAGTTGGCCTAAA pLKO_005 1979 3UTR 100% 10.800 15.120 N Tcf7 n/a
4 TRCN0000360415 CCTCAATGCGTTCATGCTTTA pLKO_005 756 CDS 100% 10.800 15.120 N Tcf7 n/a
5 TRCN0000012681 CAATGCGTTCATGCTTTACAT pLKO.1 759 CDS 100% 5.625 7.875 N Tcf7 n/a
6 TRCN0000012679 GCGGGATAACTACGGAAAGAA pLKO.1 954 CDS 100% 5.625 7.875 N Tcf7 n/a
7 TRCN0000360414 TTCTCCACTCTACGAACATTT pLKO_005 321 CDS 100% 13.200 9.240 N Tcf7 n/a
8 TRCN0000360342 TTAGATCTATGTAGATGTATC pLKO_005 1491 3UTR 100% 10.800 7.560 N Tcf7 n/a
9 TRCN0000012682 CTTTCTCCACTCTACGAACAT pLKO.1 319 CDS 100% 4.950 3.465 N Tcf7 n/a
10 TRCN0000262740 GTTCACCCACCCATCCTTGAT pLKO_005 576 CDS 100% 4.950 3.465 N Tcf7 n/a
11 TRCN0000021675 CCTTCCGATGACAGTGCTCTA pLKO.1 1074 CDS 100% 4.050 2.835 N TCF7 n/a
12 TRCN0000281257 CCTTCCGATGACAGTGCTCTA pLKO_005 1074 CDS 100% 4.050 2.835 N TCF7 n/a
13 TRCN0000012680 GCCATATGATAGAAACCTGAA pLKO.1 678 CDS 100% 0.000 0.000 N Tcf7 n/a
14 TRCN0000262742 AGAAGCCAGTCATCAAGAAAC pLKO_005 734 CDS 100% 10.800 6.480 N Tcf7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001313981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487688 TTTGAATATCGGGTTTTTTCCAAT pLX_317 21.9% 58.6% 62.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV