Transcript: Human NM_001314023.2

Homo sapiens ybeY metalloendoribonuclease (YBEY), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
YBEY (54059)
Length:
604
CDS:
119..487

Additional Resources:

NCBI RefSeq record:
NM_001314023.2
NBCI Gene record:
YBEY (54059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001314023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133988 CATCTGAAAGCAGGTGAATTT pLKO.1 194 CDS 100% 13.200 9.240 N YBEY n/a
2 TRCN0000135168 CCTAGGAGTGGAGTATATCTT pLKO.1 259 CDS 100% 5.625 3.938 N YBEY n/a
3 TRCN0000135853 CTTCGCAGTAAGATCGAGATT pLKO.1 173 CDS 100% 4.950 3.465 N YBEY n/a
4 TRCN0000134687 GACTACAATTTGGGAGACATT pLKO.1 236 CDS 100% 4.950 3.465 N YBEY n/a
5 TRCN0000133657 GAGTATATCTTCCATCAGTGT pLKO.1 269 CDS 100% 2.640 1.848 N YBEY n/a
6 TRCN0000135131 CCAGATGACTACAATTTGGGA pLKO.1 230 CDS 100% 0.750 0.525 N YBEY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001314023.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03401 pDONR223 100% 44.4% 41.3% None (many diffs) n/a
2 ccsbBroad304_03401 pLX_304 0% 44.4% 41.3% V5 (many diffs) n/a
3 TRCN0000476740 CGTTTTACCATCTAGCTCGATGCT pLX_317 100% 44.4% 41.3% V5 (many diffs) n/a
Download CSV