Transcript: Mouse NM_001314035.1

Mus musculus dystrophin, muscular dystrophy (Dmd), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Dmd (13405)
Length:
4496
CDS:
146..2014

Additional Resources:

NCBI RefSeq record:
NM_001314035.1
NBCI Gene record:
Dmd (13405)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001314035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077143 CCACCAAATGACTGCTTCATA pLKO.1 2557 3UTR 100% 5.625 3.938 N Dmd n/a
2 TRCN0000053245 CCAGCATTACTGCCAAAGTTT pLKO.1 1318 CDS 100% 5.625 3.938 N DMD n/a
3 TRCN0000077144 GCCAATAATAAACCTGAGATT pLKO.1 749 CDS 100% 4.950 3.465 N Dmd n/a
4 TRCN0000053246 CCAGTCTTTAGCTGACCTGAA pLKO.1 217 CDS 100% 4.050 2.835 N DMD n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2387 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001314035.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06103 pDONR223 100% 92.3% 97.6% None (many diffs) n/a
2 ccsbBroad304_06103 pLX_304 0% 92.3% 97.6% V5 (many diffs) n/a
3 TRCN0000481202 TACATTCTGGCATTCTTTAAGCAA pLX_317 24.3% 92.3% 97.6% V5 (many diffs) n/a
Download CSV