Transcript: Mouse NM_001316672.1

Mus musculus protein kinase C, beta (Prkcb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Prkcb (18751)
Length:
2756
CDS:
221..2236

Additional Resources:

NCBI RefSeq record:
NM_001316672.1
NBCI Gene record:
Prkcb (18751)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360378 TTGTCAGATCCCTACGTTAAA pLKO_005 791 CDS 100% 13.200 18.480 N Prkcb n/a
2 TRCN0000012455 CCGGATGAAACTGACCGATTT pLKO.1 1225 CDS 100% 10.800 15.120 N Prkcb n/a
3 TRCN0000012454 CGGTATATTGACTGGGAGAAA pLKO.1 2021 CDS 100% 4.950 6.930 N Prkcb n/a
4 TRCN0000003118 CAAGTTTAAGATCCACACGTA pLKO.1 526 CDS 100% 2.640 2.112 N PRKCB n/a
5 TRCN0000360379 GAGATTCAGCCACCTTATAAA pLKO_005 2054 CDS 100% 15.000 10.500 N Prkcb n/a
6 TRCN0000012456 CCCGGAGCAAACACAAGTTTA pLKO.1 513 CDS 100% 13.200 9.240 N Prkcb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01282 pDONR223 100% 87.6% 94.5% None (many diffs) n/a
2 ccsbBroad304_01282 pLX_304 21% 87.6% 94.5% V5 (many diffs) n/a
3 TRCN0000481367 ACAAAATTCATGAGACGGCGACCG pLX_317 20.8% 87.6% 94.5% V5 (many diffs) n/a
4 ccsbBroadEn_14789 pDONR223 0% 87.6% 94.5% None (many diffs) n/a
5 ccsbBroad304_14789 pLX_304 0% 87.6% 94.5% V5 (many diffs) n/a
6 TRCN0000480223 GGTCTACGGACGGTGCGACGAGTG pLX_317 19.6% 87.6% 94.5% V5 (many diffs) n/a
7 TRCN0000489742 CCCTCCTTCCGAGTCAGGAGGATA pLX_317 18.5% 87.6% 94.3% V5 (many diffs) n/a
8 TRCN0000488865 GGTTCCGGATAACAGTCTTTCTTT pLX_317 18.7% 87.6% 94.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV