Transcript: Mouse NM_001316679.1

Mus musculus protein tyrosine phosphatase, receptor type, E (Ptpre), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Ptpre (19267)
Length:
5151
CDS:
64..2163

Additional Resources:

NCBI RefSeq record:
NM_001316679.1
NBCI Gene record:
Ptpre (19267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220425 CGTCATGTTGACGAACCTGAA pLKO.1 750 CDS 100% 4.050 5.670 N Ptpre n/a
2 TRCN0000220424 CGGTGACTCATGGAGATATAA pLKO.1 1694 CDS 100% 15.000 10.500 N Ptpre n/a
3 TRCN0000235612 ACTCATGGAGATATAACTATA pLKO_005 1699 CDS 100% 13.200 9.240 N Ptpre n/a
4 TRCN0000235610 CAAGAGTTCACAGACTATATC pLKO_005 1486 CDS 100% 13.200 9.240 N Ptpre n/a
5 TRCN0000220423 CCTTCCTAATTCCTTTGTATA pLKO.1 2264 3UTR 100% 13.200 9.240 N Ptpre n/a
6 TRCN0000235614 TCATAGCACTCAGTAACATTT pLKO_005 1979 CDS 100% 13.200 9.240 N Ptpre n/a
7 TRCN0000235611 TGTTATACCAGGCCATCTATT pLKO_005 2974 3UTR 100% 13.200 9.240 N Ptpre n/a
8 TRCN0000220427 CCAAGCCTTACTGGAATACTA pLKO.1 1224 CDS 100% 5.625 3.938 N Ptpre n/a
9 TRCN0000220426 CCGAGAGGAGTTCAATTCATT pLKO.1 465 CDS 100% 5.625 3.938 N Ptpre n/a
10 TRCN0000235613 AGGATAAATGCTACCAGTATT pLKO_005 1658 CDS 100% 13.200 7.920 N Ptpre n/a
11 TRCN0000315212 AGGATAAATGCTACCAGTATT pLKO_005 1658 CDS 100% 13.200 7.920 N PTPRE n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3169 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316679.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06817 pDONR223 100% 86.6% 93.1% None (many diffs) n/a
2 ccsbBroad304_06817 pLX_304 0% 86.6% 93.1% V5 (many diffs) n/a
3 TRCN0000478447 GGGGGCCTAAGAAGTTATTTTTAG pLX_317 13.3% 86.6% 93.1% V5 (many diffs) n/a
Download CSV