Transcript: Mouse NM_001316732.1

Mus musculus family with sequence similarity 213, member A (Fam213a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Fam213a (70564)
Length:
1628
CDS:
126..824

Additional Resources:

NCBI RefSeq record:
NM_001316732.1
NBCI Gene record:
Fam213a (70564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001316732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176473 CGGTATTTGAAGTGAAGTTTA pLKO.1 1144 3UTR 100% 13.200 10.560 N Fam213a n/a
2 TRCN0000345709 CGGTATTTGAAGTGAAGTTTA pLKO_005 1144 3UTR 100% 13.200 10.560 N Fam213a n/a
3 TRCN0000177317 GATTTCCAACCTTACTTCAAA pLKO.1 501 CDS 100% 5.625 3.938 N Fam213a n/a
4 TRCN0000298073 GATTTCCAACCTTACTTCAAA pLKO_005 501 CDS 100% 5.625 3.938 N Fam213a n/a
5 TRCN0000182236 CCCAGACAGAACAGAGTTCAA pLKO.1 1024 3UTR 100% 4.950 3.465 N Fam213a n/a
6 TRCN0000292926 CCCAGACAGAACAGAGTTCAA pLKO_005 1024 3UTR 100% 4.950 3.465 N Fam213a n/a
7 TRCN0000182272 GAGGCGGAAGATGATGTTCAT pLKO.1 566 CDS 100% 4.950 3.465 N Fam213a n/a
8 TRCN0000292987 GAGGCGGAAGATGATGTTCAT pLKO_005 566 CDS 100% 4.950 3.465 N Fam213a n/a
9 TRCN0000200329 GATGTCCTTGAAGCCCAAGTT pLKO.1 419 CDS 100% 4.950 3.465 N Fam213a n/a
10 TRCN0000198479 GCCGGTATTTGAAGTGAAGTT pLKO.1 1142 3UTR 100% 4.950 3.465 N Fam213a n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1311 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001316732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12803 pDONR223 100% 78.4% 81.8% None (many diffs) n/a
2 ccsbBroad304_12803 pLX_304 0% 78.4% 81.8% V5 (many diffs) n/a
3 TRCN0000469237 AATACCCTTACAGACCATGGATAC pLX_317 60.2% 78.4% 81.8% V5 (many diffs) n/a
Download CSV